A1BG regulatory elements and regions: Difference between revisions

Latest revision as of 17:52, 25 April 2023

It may be still fair to say that in the apparent present era of functional genomics, the challenge is to elucidate gene function such as that of A1BG, its likely regulatory networks and signaling pathways.^[1] "Since regulation of gene expression in vivo mainly occurs at the transcriptional level, identifying the location of genetic regulatory elements is a key to understanding the machinery regulating gene transcription. A major goal of current genome research is to identify the locations of all gene regulatory elements, including promoters, enhancers, silencers, insulators and boundary elements, and to analyze their relationship to the current annotation of human genes."^[2]^[3] Although "many genome-wide strategies have been developed for identifying functional elements", "no method yet has the resolution to precisely identify all regulatory elements or can be readily applied to the entire human genome."^[4]

"The experimental evidence demonstrates that genome binding specificity is achieved through the interplay of at least three factors: DNA sequence; DNA shape; and occlusion by chromatin."^[5]

There is one CRISPRi-validated cis-regulatory element on 19q13.43: Gene ID: 116286197 LOC116286197. And, four Sharpr-MPRA regulatory regions: (1) Gene ID: 112553117 LOC112553117 Sharpr-MPRA regulatory region 1998, Gene ID: 112553119 LOC112553119 Sharpr-MPRA regulatory region 10473, Gene ID: 112577453 LOC112577453 Sharpr-MPRA regulatory region 7872, and Gene ID: 112577454 is Sharpr-MPRA regulatory region 9894.

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"^[6] are called response elements.

Heterodimers

Some bZIP proteins, "including LIP19, OsZIP-2a, and OsZIP-2b, do not bind to DNA sequences. Instead, these bZIP proteins form heterodimers with other bZIPs to regulate transcriptional activities (Nantel and Quatrano, 1996; Shimizu et al., 2005)."^[7]

DNase I hypersensitive sites

"This genomic region represents a DNase I hypersensitive site (DHS) that was predicted to be an enhancer by the ENCODE (ENCyclopedia Of DNA Elements) project based on various combinations of H3K27 acetylation and binding of p300, GATA1 and RNA polymerase II in K562 erythroleukemia cells. It was validated as a high-confidence cis-regulatory element for the ZNF582 (zinc finger protein 582) gene on chromosome 19 based on multiplex CRISPR/Cas9-mediated perturbation in K562 cells."^[8]

Gene ID: 116286197 CRISPRi-validated cis-regulatory element chr19.6329 is at NC_000019.10 (56186901..56187499).^[8]

Gene ID: 147948 ZNF582 is at NC_000019.10 (56382751..56393585, complement).^[9] The CRISPRi-validated cis-regulatory element chr19.6329 is (56382751 - 56186901) = 195850 nts from the beginning of ZNF582.

Transcriptional regulatory regions

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."^[10]

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 5:Enh, candidate strong enhancer, open chromatin). It also displayed weak repressive activity by Sharpr-MPRA in K562 erythroleukemia cells (group: K562 Repressive non-DNase unmatched - State 24:Quies, heterochromatin/dead zone)."^[11]

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in both HepG2 liver carcinoma cells (group: HepG2 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region) and K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss)."^[12]

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."^[13]

"The growth hormone-regulated transcription factors STAT5 and BCL6 coordinately regulate sex differences in mouse liver, primarily through effects in male liver, where male-biased genes are upregulated and many female-biased genes are actively repressed."^[14] "CUX2, a highly female-specific liver transcription factor, contributes to an analogous regulatory network in female liver. Adenoviral overexpression of CUX2 in male liver induced 36% of female-biased genes and repressed 35% of male-biased genes. In female liver, CUX2 small interfering RNA (siRNA) preferentially induced genes repressed by adenovirus expressing CUX2 (adeno-CUX2) in male liver, and it preferentially repressed genes induced by adeno-CUX2 in male liver. CUX2 binding in female liver chromatin was enriched at sites of male-biased DNase hypersensitivity and at genomic regions showing male-enriched STAT5 binding. CUX2 binding was also enriched near genes repressed by adeno-CUX2 in male liver or induced by CUX2 siRNA in female liver but not at genes induced by adeno-CUX2, indicating that CUX2 binding is preferentially associated with gene repression. Nevertheless, direct CUX2 binding was seen at several highly female-specific genes that were positively regulated by CUX2, including A1bg [A1BG in humans], Cyp2b9, Cyp3a44, Tox [TOX in humans], and Trim24 [TRIM24 in humans]."^[14]

"Gene list comparisons were performed using the compare class utility provided by the Regulatory Sequence Analysis Tools (34). Comparisons were made with previous 3-AT and rapamycin data sets (5, 14) and with several predefined gene lists such as genes induced by promoters bound in chromatin immunoprecipitation (ChIP-chip) experiments (35), genes in the MIPS functional catalogue (36), and gene ontology categories (37) as described by Godard et al. (38). The significance of overlap between gene lists was quantitatively determined by the hypergeometric distribution (39), using the number of probe sets on the S98 array as the population size, or by calculating the representation factor (40) using the web utility Microarray Analysis Tools. Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters. The program oligo-analysis (41) was used to search the promoter regions of co-regulated genes for overrepresented sequence motifs. Analysis of the 5􏰈-noncoding regions of the GCN4-dependent activation core identified the consensus [general control responsive element] GCRE motif (TGABTVW)."^[15]

ABA-response elements

"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."^[16]

"Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."^[16]

Abf1 regulatory factors

Specific "sequences considered as exact Abf1 motif occurrences": CGTNNNNNACGA(C/T), CGTNNNNNA(C/T)GAC, CGTNNNNNA(C/T)GA(C/T), CGTNNNNN(A/G)(C/T)GA(C/T).^[5]

A boxes

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box), GACGTC (C box), TACGTA (A box), AACGTT (T box), and a GCN4 motif, namely TGA(G/C)TCA (Landschulz et al., 1988;^[17] Nijhawan et al., 2008^[18])."^[7]

"The human TGF-β1 promoter region contains two binding sequences for AP-1, designated AP-1 box A (TGACTCT) and box B (TGTCTCA), which mediate the up-regulation of promoter activity after [High glucose] HG stimulation."^[19]

Abscisic acid-responsive elements

Abscisic acid-responsive elements (CACGTG).^[20]

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."^[5]

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.^[21]

The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].^[22]

ACA boxes

The "3' end of mature hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."^[23]

ACGT-containing elements

The "binding affinities of both bZIP proteins were similar to CRE^A/T (ATGACGTCAT), a CRE sequence with flanking adenine and thymine (A/T) at positions -4 and +4. [The] bZIP domains of both STF1 and HY5 have similar binding properties for recognizing ACGT-containing elements (ACEs). [Although] the G-box is a known target site for the HY5 protein, the C-box sequences are the preferred binding sites for both STF1 and HY5."^[24]

Activating protein 2

"AP-2 proteins can bind to G/C-rich elements, such as 5’-[G/C]CCN(3,4)GG[G/C]-3’ (41, 42)."^[25]

Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC.^[26]

Activating transcription factors

"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."^[27]

Adenylate–uridylate rich elements

"The 3′UTRs were searched for the 13-bp pattern WWWUAUUUAUWW with mismatch=−1 which was computationally derived as previously described ( 2 ). The pattern was further statistically validated against larger sets of mRNA data (10 872 mRNA with 3′UTR; GenBank 119) showing occurrence of the motif in 6.8% of human mRNA."^[28]

"3′ untranslated regions play an important role in regulating mRNA fate by complexing with RNA binding proteins that help control mRNA localization, translation, and stability [1, 2, 3]. Identification of a consensus UUAUUUAU sequence in the 3′ UTRs of human and mouse mRNAs encoding tumor necrosis factor (TNF-α) and a variety of other inflammatory mediators led to the suggestion that these AU-rich elements AREs) could be important for regulating gene expression [4]."^[29]

Adr1ps

The upstream activating sequence (UAS) for Adr1p is 5'-TTGGGG-3' or 5'-TTGG(A/G)G-3'.^[22]

Aft1ps

The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).^[22]

AGC boxes

"The GCC box, also referred to as the AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."^[30]

Androgen response elements

"The androgen response element sequence, 5'-GGTACACGGTGTTCT-3', was obtained from the National Center of Biotechnology Information (NCBI)."^[31]

5'-TGGAGAACAGCCTGTTCTCCA-3' or 5'-AGAACAGCCTGTTCT-3'^[32] "Using the identified AREs within our experiment a refined extended canonical ARE model is proposed and deposited in transcription factor databases [...]."^[32]

Angiotensinogen core promoter elements

The consensus sequence is 5'-A/C-T-C/T-3'.^[33] The core nucleotides for AGCE1 include 5'-A/C-T-C/T-G-T-G-3', "located between the TATA box and transcription initiation site (positions −25 to −1) is an authentic regulator of human AG transcription."^[34]

Antioxidant-electrophile responsive elements

5'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3' is the consensus sequence of a functional antioxidant response element at the HIF1A locus.^[35], an antioxidant response element (ARE).

ATA boxes

"The 3' flanking area contained the highly conserved hexanucleotide sequence A-A-T-A-A-A found in eukaryotic messages between the terminator codon and the polyadenylylation site (44)."^[36]

AUUUA AREs

"Chen and Shyu [11] divided AREs into two classes of AUUUA-containing AREs and a third class of non-AUUUA AREs. Class I AUUUA-containing AREs had 1-3 copies of scattered AUUUA motifs coupled with a nearby U-rich region or U stretch, whereas class II AUUUA-containing AREs had at least two overlapping copies of the nonamer UUAUUUA(U/A)(U/A) in a U-rich region. Non-AUUUA AREs had a U-rich region and other unknown features, and the relationship of these sequences to AUUUA-containing AREs remains poorly understood. Subsequent studies based on analyses of a set of 4884 AUUUA-containing AREs led to a new classification based primarily on the number of overlapping AUUUA-repeats [8, 9, 10]. This classification system, with five clusters distinguished by the number of repeats, was used to identify AUUUA-containing AREs in the human genome. AREs identified using this classification were found to be abundant in 3′ UTRs of human genes."^[29]

Auxin response factors

The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."^[37] "ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]. More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."^[37]

A more general consensus sequence may be 1(C/G/T)-2N-3(G/T)-4G-5(C/T)-6(C/T)-7N-8N-9N-10N, where ARF2[b] is 1(C/G/T)-2(A/C/T)-3(G/T)-4G-5(C/T)-6(C/T)-7(G/T)-8(C/G)-9(A/C/T)-10(A/G/T) and ARF5/MP[b] is 1(C/G/T)-2N-3(G/T)-4G-5T-6C-7(G/T)-8N-9-10N.^[37] ARF1[b] has 4G.^[37]

B boxes

While there appear to be at least two B boxes, TGGGCA is one B-box,^[38] where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the Dde I site at position -140 to the Dde I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."^[38]

The other is associated with the human transforming growth factor b1 binding sequences.^[39]

And, has the consensus sequence 5'-TGTCTCA-3'.

B recognition elements

The factor II B recognition element is BRE^u.

"The transcription factor II B recognition elements BRE^u "CGACGCA" and BRE^d "ATGGTTG" were upstream (− 279 to − 273 of the transcript) and downstream (− 165 to − 159 of the transcript) of the TATA box, respectively."^[40]

The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.^[41]

The consensus sequence is 5’-G/C G/C G/A C G C C-3’.^[42]

CadC binding domains

"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."^[43] "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites."^[43] "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."^[43]

Calcineurin-responsive transcription factors

The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p) is 5'-TG(A/C)GCCNC-3'.^[22]

Carbohydrate response elements

"The putative ChREBP binding sites [are] ChoRE1 (CACGTGACCGGATCTTG, -324 to -308) and ChoRE2 (TCCGCCCCCATCACGTG, -298 to - 282) [...], where the 5-nt spacer [Carb and Carb1 is] between the two E-boxes in ChoRE motifs [CarbE1, CarbE2 and CarbE3]."^[44]

CAREs

"GARE and a novel CARE (CAACTC regulatory elements) elements are present in the promoter of rice RAmy1A (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003)."^[45]

CArG boxes

"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of MADS box proteins (Ito et al., 2008)."^[46]

"MADS-box proteins bind to a consensus sequence, the CArG box, that has the core motif CC(A/T)₆GG (15)."^[47]

"Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [...]."^[47]

Three "other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."^[47] These together with the core motif CC(A/T)₆GG (15) suggest a more general CArG-box motif of (C(C/A/T)(A/T)₆(A/G)G).

Cat8p gene transcriptions

The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T, B = C, G, T, V = A, C, G, M = A, C, and H = A, C, T; i.e. 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'.^[22]

CAT boxes

"The M-CAT consensus sequence [is] CATTCCT".^[48]

"A [chloramphenicol acetyltransferase] CAT-box-like element, GCCATT [34], adjacent to the GC-box, is conserved in the three promoters."^[48]

C boxes

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C-box) [...]."^[7]

Analysis "of the recombinant (soybean [Glycine max] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."^[24]

The human ribosomal protein L11 gene (HRPL11) has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].^[49]

"Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA)."^[50]

Substituting T for U yields C box = 5'-AGTAGT-3' in the translation direction on the template strand.

CCAAT-box-binding transcription factors

The upstream activating sequence (UAS) for the Hap4p is 5'-CCAAT-3'.^[22]

Cell-cycle boxes

"The 5' non-coding part contains the sequence elements characteristic for eukaryotic promoters such as TATA and CAAT boxes as well as an inverted motif typical for cell-cycle regulated genes named "cell-cycle box" (CCB). The consensus sequence of CCB is CACGAAAA (Nasmyth, 1985), however, more relaxed variants such as CACGAAA, ACGAAA and C-CGAAA were described in budding yeast CLN1 and CLN2 (Ogas et al, 1991)."^[51]

CGCG boxes

"The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T)."^[41]

Circadian control elements

"The circadian control element (circadian; Anderson et al., 1994) was found in 10 FvTCP genes."^[52]

Circadian control elements (CAANNNNATC).^[20]

Class C DNA binding sites

The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.^[53]

Cold-responsive elements

A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."^[54]

Copper response elements

"Chlamydomonas reinhardtii activates the transcription of the Cyc6 and the Cpx1 genes (encoding cytochrome c₆ and coprogen oxidase) in response to copper deficiency."^[55]

"A consensus copper-response element [CuRE] TTTGC(T/G)C(A/G) (12) is a binding site for Mac1p."^[55]

"An additional EMSA result demonstrated that [Aspergillus fumigatus (Af)] AfMac1 directly binds to a copper response element in the promoter regions of the ctrA2 and ctrC genes with a defined consensus DNA motif (5′-TGTGCTCA-3′) (Park et al., 2017^[56]), which is strikingly similar to the Mac1-binding motif in S. cerevisiae (Jamison McDaniels et al., 1999; Keller et al., 2000), suggesting that the mechanism of Mac1-mediated copper homeostasis may be conserved across fungal species."^[24]

Coupling elements

"In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996)."^[16]

"In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."^[16]

"To identify potential cis-regulatory elements in the promoter sequences of ZmGRXCC genes, the 1500 bp sequences of each [maize CC-type glutaredoxin (GRX)] ZmGRXCC gene upstream of the ATG start codon were selected from the maize genome as the promoter, and the promoter sequence was screened using PlantCARE [32]. The elements searched included [...] CE3 (coupling element 3, -CACGCG-) for ABA responsiveness [...]."^[57]

CRE boxes

"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."^[58]

The upstream activating sequence (UAS) for the Aca1p, the basic "leucine zipper (bZIP) transcription factor [55] involved in carbon source utilization" is 5'-TGACGTCA-3'^[22] the same as a CRE.

The upstream activating sequence (UAS) for the Sko1p, involved "in osmotic and oxidative stress responses" is 5'-TGACGTCA-3'^[22] the same as a CRE.

Root specific elements are the same as CREs.

Cytokinin response regulators

"Cytokinin fulfills its diverse roles in planta through a series of transcriptional responses."^[59]

"Cytokinin employs a two-component multi-step phosphorelay for its perception and signaling transduction^12–14. In Arabidopsis, there are three cytokinin receptors (ARABIDOPSIS HISTIDINE KINASEs; AHK2, 3, 4) and eleven type-B response regulators (ARABIDOSPIS RESPONSE REGULATORs; B-ARRs)^8,15."^[59]

"The cytokinin transcriptional response centrally affects the family of ARRs. Type-B ARRs (B-ARRs) are transcription factors (TFs) with a GARP-like DNA binding domain at their C-termini and a receiver domain at their N-termini. Type-A ARRs (A-ARRs) are similar to the N-termini receiver domain of B-ARRs but do not possess a DNA binding domain."^[59]

Cytoplasmic polyadenylation elements

"The most well-understood mechanism for controlling cytoplasmic polyadenylation is regulation of mRNAs containing the cytoplasmic polyadenylation element (CPE; consensus UUUUUAU) by CPE-binding protein (CPEB)1."^[60]

"Cytoplasmic polyadenylation is determined by the cytoplasmic polyadenylation element (CPE; consensus sequence UUUUUAU) that resides in mRNA 3′ untranslated regions (UTRs)."^[61]

DAF-16 binding elements

"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)^11–13."^[62]

D boxes

There is one D box 5'-AGTCTG-3'.^[50]

The human ribosomal protein L11 gene (HRPL11) has two potential snRNA-coding sequences in intron 4: a D box beginning at +4237 (TCCTG).^[49]

A D-box is (TGAGTGG).^[63]

DNA damage response elements

"A consensus sequence, 5'-TAGCCGCCGRRRR-3' (where R = an unspecified purine nucleoside [A/G],was generated from these data."^[64]

"The extent of homology for the entire 13 bp ranged from 56 to 100%. However, for the symmetrical core sequence CCGCC 75 to 100% homology was observed with only conservative substitutions occurring in the nonhomologous positions."^[64]

Downstream B recognition elements

The downstream B recognition element [(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)] designated as the BRE^d,^[47] or dBRE, is an additional core promoter element that occurs downstream of the TATA box and is recognized by general transcription factor II B.^[47]

Downstream core elements

A core promoter that contains all three subelements of the downstream core element [DCE] may be much less common than one containing only one or two.^[65] "S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34."^[65]

The consensus sequence for the DCE is CTTC...CTGT...AGC.^[65] These three consensus elements are referred to as subelements: "S_I is CTTC, S_II is CTGT, and S_III is AGC."^[65]

Downstream promoter elements

The early DPE consensus sequence was RGWCGTG.^[66]^[67]

The DPE consensus sequence is the more general sequence RGWYVT, or (A/G)G(A/T)(C/T)(A/C/G)T.^[68]

The DPE in "the ATP‐binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" is 5'-AGTCTC-3'.^[40]

E2 boxes

"The most dramatic impact on immunoglobulin gene enhancer activity was observed upon mutation of sites that contain an E2-box motif (G/ACAGNTGN)."^[69]

EIN3 binding sites

"We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gene [...]."^[70]

"EIN3/EIL1 transcription factors were reported to bind to a consensus DNA sequence of A[CT]G[AT]A[CT]CT [34,35]."^[70]

Endoplasmic reticulum stress response elements

"The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response element (ERSE) containing the consensus sequence CCAAT-N9-CCACG to activate genes encoding ER chaperones, ERAD components, and XBP1 (Chen et al., 2010; Yamamoto et al., 2004; Yoshida et al., 2001)."^[71]

Endosperm expression

Endosperm expression (TGTGTCA).^[20]

Enhancer boxes

The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence of CACGTG.^[72]

Ethylene responsive elements

Ethylene responsive elements (ATTTCAAA).^[20]

Forkhead boxes

"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)^11–13."^[62]

GAAC elements

"[A] short sequence [in TSE1 contains] a GAACT motif that [binds] a tendon-specific nuclear protein."^[73]

GA responsive elements

"Although this GARC [GA responsive complex] may not always be tripartite, most often it includes three sequence motifs, the TAACAAA box or GA responsive element (GARE), the pyrimidine box CCTTTT, and the TATCCAC box (Skriver et al., 1991;Gubler and Jacobsen, 1992; Rogers et al., 1994)."^[74]

Several GA-responsive cis-acting elements (GARE) and GARE-like elements (TAACAA/GA, or TAACGTA) have been identified in the promoters of hydrolase genes expressed in the aleurone (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003; Washio 2003), expansin genes expressed in internodes (Lee et al. 2001), and many GAMYB-regulated genes expressed in anthers (Tsuji et al. 2006)."^[45]

GATA boxes

GTGA-box has the consensus sequence GATA.^[75]

GC boxes

"A GC box sequence, one of the most common regulatory DNA elements of eukaryotic genes, is recognized by the Spl transcription factor; its consensus sequence is represented as 5'-G/T G/A GGCG G/T G/A G/A C/T-3' [or 5′-KRGGCGKRRY-3′] (Briggs et al., 1986)."^[76]

GCC elements

"The GCC box, also referred to as the AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."^[30]

Gcn4ps

"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."^[15]

"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -􏰉206 and -􏰉112, respectively, [...]."^[15]

GGC triplets

"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)₂Cys₆ proteins), and they recognize highly related sequences rich in GGC triplets [15]."^[77]

"MEME analysis identified phylogenetically conserved CCGN₄CGG motifs in promoters of several [branched-chain amino acid] BCAA biosynthetic genes"^[78]

Gibberellin responsive elements

Gibberellin responsive elements (CCTTTTG, AAACAGA).^[20]

Γ-interferon activated sequences

"Computer analysis of the nt −653 to nt −483 region identified two sites that resemble the [γ-interferon activated sequence] GAS consensus sequence, TTNCNNNAA (19). Similar GAS-like sites have been shown to mediate the effects of various cytokines, including [growth hormone] GH, on the transcription of other genes (19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt −633 and nt −625; the second site, TTAGACAAA (ALS-GAS2), is located between nt −553 and nt −545."^[79]

Glucocorticoid response elements

"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."^[80]

Gcr1ps

The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in the regulation of glycolysis [77].^[22]

GT boxes

"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."^[81]

Hac1s

"The similar UPRE-1 is also found in the promoter region of the P. pastoris KAR2 (CAGCGTG), INO1 (CAACTTG) and HAC1 (CAACTTG) genes [15]. The presence of an HAC1 UPRE implies that Hac1p can up-regulate its own transcription. Unconventional splicing of HAC1 mRNA after ER stress signaling generates the active form of basic leucine zipper (bZIP) transcription factor Hac1p, which binds to the UPRE [16]."^[82]

H boxes

"The box H/ACA snoRNAs [...] have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity."^[23]

The "3' end of mature [human telomerase] hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."^[23]

"Comparison with the murine telomerase RNA (mTR) (7) suggests that the snoRNA-like features of hTR are evolutionarily conserved. The mTR 3' end [...] includes consensus H (5'-ACAGGA-3') and ACA box sequences."^[23]

An H box has a consensus sequence of 3'-ACACCA-5'.^[83]

"In humans, telomerase is composed of a reverse transcriptase (hTERT), which uses the RNA component (hTERC) to dock onto the 3′ single-stranded telomere end. hTERT may then processively synthesise telomeric repeats from the template provided by hTERC, before dissociating^7–9. All telomerase RNAs possess a 3′ end element necessary for its stability¹⁰. In hTERC, this is two stem-loop structures separated by an H-box (ANANNA) and ACA motif (H/ACA). The binding of telomerase factors dyskerin, NOP10, and NHP2 at the H/ACA motif form the so-called ‘pre-ribonucleoprotein complex’, before GAR1 binds in transition to the mature RNP^11,12. hTERC then binds to chaperone TCAB1, which assists its trafficking to the Cajal bodies where the functional telomerase complex localises¹³. Recruitment to the telomeres in S-phase is mediated by the protective complex shelterin^14,15. Correct assembly of the telomerase complex, with appropriate co-factors for maturation, stability, and subcellular localisation, is necessary for its function and thus telomere maintenance."^[84]

"The KAP-2 protein [...] binds to the H-box (CCTACC) element in the bean CHS15 chalcone synthase promoter".^[85]

"Two distinct sequence elements, the H-box (consensus CCTACC(N)₇CT) and the G-box (CACGTG), are required for stimulation of the chs15 promoter by 4-CA."^[86]

Heat shock elements

"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In Saccharomyces cerevisiae, this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."^[87]

"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."^[87]

Hex sequences

The Hex sequence has the consensus (TGACGTGGC).^[24]

HMG boxes

"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."^[88]

HNFs

Gene ID: 6927 is HNF1A HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."^[89]

"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1."^[90] TCF-1 binding site is CCTTTGA.^[90]

"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."^[91]

Homeoboxes

"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."^[92]

The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln₅₀ in TTF-1 HD is utilized for DNA recognition."^[93]

Hsf1ps

The upstream activating sequence (UAS) for the Hsf1p is NGAAN.^[22]

"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."^[87]

Hypoxia response elements

"Putative EPO promoter HREs. Location of two conserved potential promoter HREs (pHRE1 and pHRE2; [CACGC]) close to the GATA ([GATA]) and [Wilms tumor gene] WT1 ([GCCTCTCCCCCACCCCCACCCGCGCACGCAC]) sites in the EPO proximal 5' region. [For human and other vertebrates] is a UCSC Genome Browser output (version hg19), including 161 transcription factor ChIP-sequencing (ChIP-seq) tracks derived from the ENCODE database (version 3), clusters of DNaseI hypersensitivity sites (HSS) from 125 cell types, and the transcriptional start site (TSS), with a closer view of the region in 50 vertebrates extracted using the 100-MULTIZ whole-genome multiple sequence alignment algorithm."^[94]

HY boxes

"Deletion analysis by a series of 5′-deletion constructs identified the responsive region to RUNX-2 as being between −81 bp and −76 bp, containing a putative RUNX-2 binding sequence (TGAGGG), which is similar to that identified in the promoter region of human interleukin-3 (TGTGGG) (33)."^[95]

"Deletion, mutagenesis, and tandem repeat analyses identified the core responsive element as the region between −89 and −60 bp (termed the hypertrophy box [HY box]), which showed specific binding to RUNX‐2."^[95]

Initiator elements (YYANWYY)

The Inr has the consensus sequence YYANWYY.^[96]

Initiator elements (BBCABW)

"Kadonaga and colleagues (Vo ngoc et al. 2017) devised and implemented a novel multistep approach that combines experimental and computational methods to reinvestigate the human Inr consensus sequence. First, they generated two 5′-GRO-seq (5′ end-selected global run-on followed by sequencing) libraries with human MCF-7 cells to identify the 5′ ends of nascent capped transcripts. Second, they developed a peak-calling algorithm named FocusTSS to find transcripts in the 5′-GRO-seq data sets that were initiated at a focused position on the genome, hence identifying clear TSSs to enable analysis of Inr sequences. FocusTSS identified 7678 TSSs that were in both data sets. Third, to identify sequence motifs enriched among the focused TSSs, they used the HOMER motif discovery tool (Heinz et al. 2010), which yielded an Inr-like consensus sequence of BBCABW from −3 to +3 (where, B = C/G/T, W = A/T, and +1 is [A]). Forty percent of the focused TSSs contained a perfect match to the BBCABW consensus Inr."^[97]

Initiator-like element, TCT

Consensus sequence for an Inr-like/TCT is TTCTCT.^[40]

Inositol/choline-responsive elements

"This ICRE (consensus sequence TYTTCACATGY) contains the core sequence CANNTG, which is also known as an E box and which serves as a recognition site for DNA-binding proteins of the basic helix-loop-helix (bHLH) family (3). Members of the bHLH family comprise determinants of cellular differentiation and proliferation in mammalian and invertebrate systems such as the myogenic transcription factors MyoD, MRF4, myogenin and Myf-5(4) as well as factors not restricted to specialized tisues (E12, E47, daughterless, c-Myc and Mad; 5-7). Proteins of the bHLH group may form either homodimers or heterodimers or both, dependent on the individual structure of the respective interaction surface provided by the HLH domain(8)."^[98]

"The UAS INO is thus also referred to as the inositol/choline-responsive element (ICRE). The UAS INO contains the consensus sequence CATGTGAAAT, which includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991)."^[99]

"All IN01 fusion constructs that retained regulation in response to the phospholipid precursors inositol and choline, contained at least one copy of a nine bp repeated element (consensus, 5'-ATGTGAAAT-3')."^[100]

Interferon regulatory factors

Consensus sequence for IRF-3 is 5'-GCTTTCC-3'.^[44]

There "are totally 11 members (from IRF-1 to IRF-11) identified from vertebrates [10]. All the IRF members share a well-conserved N-terminal helix-turn-helix IRF superfamily domain (also called DNA-binding domain, DBD) with five conserved tryptophan (Trp) residues, which could recognize DNA sequences containing 5’-GAAA-3’ tetranucleotide, such as the IFN-stimulated response element (ISREs, GAAANNGAAA) [11, 12]. Moreover, it was reported that the IRS consensus (-78/-66, AANNGAAA), which existed in the promoter region of IFN-β, could be bound by the IRF family members [13]. As for the C-terminus, most of the IRFs share an IRF-3 superfamily domain, which was also named as IRF associated domain 1 (IAD1). IRF-1 and IRF-2 do not possess conserved IAD1 domain, but they contain non-conserved activation domain (the last 100 amino acids of IRF-1 were rich in tyrosine) or repression domain (the final 25 amino acids of IRF-2 were rich in histidine, arginine and lysine) in their C-terminus, respectively."^[101]

Jasmonic acid-responsive elements

Jasmonic acid-responsive elements (TGACG, CGTCA).^[20]

Krüppel-like factors

"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."^[102]

"Using the in vitro CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."^[102]

Leu3

With HAS1 ending at zero and TDA1 beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G), 569 - 574 Mig1 (C/T)(C/T)CC(A/G)G and Sdd4 (A/C/T)CCCAC, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T).^[103]

M35 boxes

The trp promoter has a consensus -35 sequence (TTGACA).^[104]

M-boxes

"The conserved region contains a consensus M-box element (TCACATGA) for binding of MITF. This MITF binding site is aligned and conserved between at least 11 different species [...]. The clear conservation of these elements suggests that gpnmb has similar regulation in all mammals."^[105]

Mcm1 regulatory factors

Consensus sequences: NN(A/C/T)(A/C/T)NC(C/T)(A/C/T)(A/C/T)(A/T)(A/C/T)(A/C/T)N(A/G)(C/G/T)(A/C/T)NNN.^[5]

The primary consensus sequence is apparently TT(A/T)CCNN(A/T)TNGG(A/T)AA.^[5]

A "subset of bound and unbound motif occurrences [...] contained all of the most highly conserved nucleotides of the 16-bp pseudosymmetric motif (TTnCCnnnTnnGGnAA) ([...] Shore and Sharrocks 1995; Hughes and de Boer 2013)."^[5]

Met31ps

Consensus sequence for Met31 binding motif is AAACTGTGG in sulfur amino acid metabolism.^[22]

"Both Met31p and Met32p bind to the 5′‐AAACTGTG‐3′ core sequence which is, besides the 5′‐TCACGTG‐3′ element, the second regulatory element known to be involved in the regulation of several MET genes (Thomas et al., 1989)."^[106]

Metal responsive elements

"To execute the transcriptional regulation, [Metal-responsive transcription factor-1] MTF-1 binds to the specific site, called [metal responsive element] MRE (core sequence = TGCRCNC), in the promoter region of target gene (Günther et al. 2012a)."^[107]

Middle sporulation elements

"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."^[108]

Of the midsporulation element (MSE), "a minimal element, CRCAAA(A/T), is sufficient for sporulation specificity."^[109]

Mig1ps

The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or 5'-(C/G)(C/T)GGGG-3'.^[22]

Msn2,4p

The upstream activating sequence (UAS) for the Msn2,4p transcription factor is 5'-CCCCT-3'.^[22]

"[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core pentameric cis-acting sequence CCCCT and is located in promoter regions of the induced genes."^[110]

Musashi binding elements

"The 24-nt Xenopus Mos [polyadenylation response element] PRE (Charlesworth et al, 2002) contained a match to the SELEX-derived murine Musashi RNA binding consensus sequence (G/AU₁₋₃AGU) (Imai et al, 2001), and included a 3′ U residue essential for PRE function (Charlesworth et al, 2002) [...]."^[111]

"Regarding the 3′ UTR cis-regulatory sequences such as AREs (PAS) [110], BRD-Box [111] and MBE [112] mediates negative post-transcriptional regulation by affecting mRNA transcript stability and translational efficiency [110], [140]. In our case, the 3′ cis-regulatory signals, BRD-Box and MBE, located upstream and downstream PAS [...] may regulate tissue-specific alternative polyadenylation which has been detected in approximately 54% of human genes [142]."^[112]

"The [Musashi-binding element] MBE consensus sequence is (G/A)U_1–3AGU."^[113]

MYB recognition elements

"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."^[114]

MYB binding site involved in drought induction (TAACTG).^[20]

Myocyte enhancer factor 2 (MEF2)

Myocyte enhancer factor-2 (MEF2) proteins are a family of transcription factors which through control of gene expression are important regulators of cellular differentiation and consequently play a critical role in embryonic development.^[115] In adult organisms, Mef2 proteins mediate the stress response in some tissues.^[115]

"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."^[116] Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).^[116]

Nanos/Pumilio response elements

"The 3′ UTR of eEF1A contains a putative [Nanos/Pumilio response element (PRE)] PRE sequence (TGTAAAT), suggesting that it is a Nanos/Pumilio target."^[117]

Recurrent "kmers occurring in 3′ UTRs were identified in the single-read FLASH data. The polyadenylation signal [ ATA box ] AATAAA had the highest Z-score, and three similar sequences were also found in the top 10 kmers. However, on correlation with down-regulation, the TGTAAAT motif was found by MEME (Bailey and Elkan 1994) at 294 sites (E-value 2.7 × 10⁻⁵⁶²), which is different from the motif identified by RIP-seq [...]."^[118]

N-boxes

"Human pColQ1a carries consensus sequences for transcriptional factors E-protein (E-box, CANNTG), NFAT (GGAAA), c-Ets transcription factor [c-Ets, (C/A)GGA(A/T)], Elk-1, N-box (CCGGAA), and MEF2 (CTAAAAATAA), which play essential roles in muscle-specific and NMJ-specific transcriptional activities (Lee et al., 2004)."^[119]

"The [basic helix–loop–helix] bHLH proteins from group E were usually bound to the CACGCG [Coupling element] or CACGAG (N-box) motif."^[120]

"Group E comprises two families in which the proteins have a conserved Pro or Gly residue within the basic region that mediates preferential binding to the N-box sequences CACGGC or CACGAC."^[121]

"The HEY1 gene binds E-box (CANGTG) and N-box (CACNAG) sites (31,32)."^[122]

The "putative consensus binding sites of Notch target genes in human IDE promoter" included the N-box from "the first translation start site (ATG)" -3711/-3715 position in a forward (+) orientation with a consensus sequence of CACNAG of the bHLH protein HES-1 with a strong DNA binding activity.^[53] For the closer binding position -310/-305 in a reverse (-) orientation of the bHLH protein Hey-1 CACNAG had a weak DNA binding activity.^[53] The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.^[53]

Non-DiTyrosine 80 transcription factors

"The Saccharomyces cerevisiae Ndt80 protein is the founding member of a class of p53-like transcription factors that is known as the NDT80/PhoG-like DNA-binding family."^[123]

Ndt80 [Non-DiTyrosine 80] is a meiosis-specific transcription factor required for successful completion of meiosis and spore formation.^[124] The DNA-binding domain of Ndt80 has been isolated, and the structure reveals that this protein is a member of the Ig-fold family of transcription factors.^[125] Ndt80 also competes with the repressor SUM1 for binding to promoters containing MSEs.^[126]

Direct "binding of Ndt80 to the [mid sporulation element CRCAAAA/T (Ozsarac et al. 1997)] MSE is necessary for activating transcription of the middle sporulation genes."^[127]

"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."^[108]

Nuclear factor of activated T cell transcriptions

Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).³"^[128]

Nuclear factor 1

Nuclear factor 1 (NF-1) is a family of closely related transcription factors that constitutively bind as dimers to specific sequences of DNA with high affinity.^[129] Family members contain an unusual DNA binding domain that binds to the recognition sequence 5'-TTGGCXXXXXGCCAA-3'.^[130]

Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.^[131]

An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).

Nutrient-sensing response element 1

There is only one nucleotide difference between the SESN2 CARE and the ATF4-inducible asparagine synthase gene ASNS consensus sequence (GTTTCATCA).^[132]

Oaf1 transcription factors

The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN₃TNAN_9-12CCG-3'.^[22]

ORE1 binding sites

"As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [37]."^[70]

Consensus sequences are 5'-(A/C/G)(A/C)GT(A/G)N_5,6(C/T)AC(A/G)-3' or 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.^[70]

p53 response elements

"A p53 consensus DNA RE is composed of a tandem of two decameric palindromic sequences (half-sites) 5′-RRRCWWGYYY-3′, where R = purine, Y = pyrimidine and W is either A or T. There is a variability in composition of p53 REs, thus two half-sites can be separated by a spacer DNA, typically 0–13 bp in length and many p53 DNA REs have varying numbers of half-sites (19,20,22,33–37)."^[133]

p53 response elements found in the promoter of TUG1: 5'-CAGGCCC-3' and 5'-GGGCGTG-3'.^[44]

P boxes

"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."^[134]

Peroxisome proliferator-activated receptor alpha

Consensus sequence is 5'-CGACCCC-3'.^[44]

Phosphate starvation-response transcription factors

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."^[5]

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.^[21]

The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].^[22]

Pollen1 elements

"Electrophoretic mobility shift assays identified a pollen-specific cis-acting element POLLEN1 (AGAAA) mapped at AtACBP4 (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."^[75]

"Given that AtACBP4pro::GUS (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 cis-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."^[75]

"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato LAT52 (Bate and Twell 1998)."^[75]

Polycomb response elements

"Two predicted [Pleiohomeotic] Pho-Phol binding sites, CGCCATTT, that closely resemble the extended Pho-Phol consensus sequence, CGCCAT(T/A)TT (Kahn et al. 2014), are located within PRE1.1 [...]."^[135]

Pribnow boxes

"Two domains upstream of the start site of transcription have been identified for which a consensus sequence has been formulated(1-5). These domains are the -35 sequence (5'-T-T-G-A-C-A) and the Pribnow box (5'-T-A-T-A-A-T) in the -10 region. Both domains are in close contact with the RNA polymerase during initiation of RNAsynthesis (2,6)."^[104]

Prolamin boxes

"The main cis-element present in their promoters is an endosperm-specific box [19,20], which consists of two motifs: a GLM (GCN4-like motif) (5′ G(A)TGA(G) GTCAT 3′) that shares homology with yeast GCN4 [21], and a 7 bp P-box (Prolamin box) (5′TGTAAAG3′) [22–24]."^[136]

Pyrimidine boxes

"Prediction of cis-regulatory elements using bioinformatics tools: Upstream 1500bp sequence of transcriptional start site of each gene were searched using PLANTCARE database to identify the cis-regulatory elements of NtSUT1-5 genes. Moreover, manual scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."^[137]

"Promoter analysis of five SUTs revealed the presence of sugar responsive element, A-box (TACGTA), which is involved in regulation of sucrose transporters upon addition of sucrose (Kühn, 2011; Osuna et al., 2007). Sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) important for sugar responsive gene expression, pyrimidine box (CCTTTT) (Washio, 2003) partially involved in sugar repression were also observed."^[137]

Q elements

"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."^[75]

The consensus sequence for a Q element is 5'-AGGTCA-3'.^[75]

Quinone reductase response elements

The quinone reductase (QRDRE) gene contains TCCCCTTGCGTG which has the DRE core of TNGCGTG.^[138]

Rap1 regulatory factors

Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).^[5]

"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."^[5]

Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.

Reb1 general regulatory factors

Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."^[5]

Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.

Retinoblastoma control elements

"Robbins et al. (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-fos and have identified an element, termed the retinoblastoma control element (RCE), in the c-fos promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-β1, -β2, and -β3 promoters by Kim et al. (19)."^[139]

"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."^[140]

"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-O-tetradecanoylphorbol-13-acetate (TPA) (15-20)."^[140]

Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."^[140]

Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-O-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).^[140]

"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human PAI-1 gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."^[63]

"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."^[63]

D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).^[63]

Retinoic acid response elements

Retinoic acid response elements (RAREs).

"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."^[141]

"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."^[142]

"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, vitamin D receptors (VDR) and peroxisome proliferator-activated receptors (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."^[142]

Additional response elements that include the 5'-AGGTCA-3' are Q elements, ROR-response elements and Thyroid hormone response elements.

A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.^[142]

Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.

Rgt1 transcription factors

"Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between HAS1pr-TDA1pr alleles in saturated cultures of Saccharomyces yeast is mediated by three transcription factors, Leu3, Sdd4 (Ypr022c), and Rgt1. The coincident, combined binding of all three factors is strongest at the HAS1pr-TDA1pr locus and is also specific to saturated conditions. We applied MAP-C to further explore the biochemical mechanism of these contacts, and find they require the structured regulatory domain of Rgt1, but no known interaction partners of Rgt1."^[103]

With HAS1 ending at zero and TDA1 beginning at above 1000 bp, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T), the third Rgt1 is the inverse of the first two.^[103]

Rgt1 is also known as glucose transporter gene repressor.

Root specific elements

Root specific elements (TGACGTCA).^[20]

ROR-response elements

RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)^{13, 31}."^[143]

Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

R response elements

The consensus sequence for the RRE is 5'-CATCTG-3'.^[144]

Serum response elements

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.^[145]

5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.

5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.

5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".

5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.

Servenius sequences

The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."^[146]

Specificity proteins

Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).^[63]

"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."^[63]

Sp-1 (CCGCCCC).^[140]

Sp1 (GCGGC).^[131]

SP1 (GGGGCGGGCC).^[44]

An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 5'-(C/G)(C/G/T)G(C/G)C(C/T)-3'. Or, each must be considered separately.

Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.

STATs

A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.^(37–40)"^[147] Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.^[147]

"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."^[148]

Ste12p

The upstream activating sequence (UAS) for [Sterile 12 protein] Ste12p is 5'-TGAAAC-3'.^[22]

Sucrose boxes

Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."^[137]

Synaptic Activity-Responsive Elements

"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."^[149]

"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."^[58]

The consensus sequence for the myocyte enhancer factor 2 (MEF2) is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).^[116]

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.^[145]

TACTAAC boxes

"A consensus sequence TACTAA(C/T) was derived for the branch site of Dictyostelium introns."^[150]

TAGteams

The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."^[151]

Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.

Tapetum boxes

The consensus sequence for the TAPETUM box is TCGTGT.^[75]

TATA boxes

"About 24% of human genes have a TATA-like element and their promoters are generally AT-rich; however, only ~10% of these TATA-containing promoters have the canonical TATA box (TATAWAWR)."^[41]

TAT boxes

Only an inverse and its complement occurs between ZSCAN22 and A1BG: 5'-TACCTAT-3' at 2996 nts from ZSCAN22.

T boxes

"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."^[152]

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."^[7]

"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."^[153]

TEA consensus sequences

"The TEA/ATTS transcription factor family consists of mammalian, avian, nematode, insect and fungal members that share a conserved TEA domain. The TEA domain (Bürglin, 1991) represents a DNA‐binding region that is composed of 66–76 conserved amino acids (aa) in the N‐terminal section of the proteins."^[154]

"The TEA consensus sequence (TCS) in a fungal TEA/ATTS transcription factor target promoter has been defined as 5′‐CATTCY‐3′ (Andrianopoulos and Timberlake, 1994)."^[154]

Tec1ps

The upstream activating sequence (UAS) for Tec1p is 5'-GAATGT-3'.^[22]

Telomeric repeat DNA-binding factors

In the nucleotides between ZSCAN22 and A1BG there is are ten 5'-TTAGGG-3' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.

Homo sapiens genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".^[155]

Thyroid hormone response elements

"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."^[156]

Transcription factor 3

Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a protein that in humans is encoded by the TCF3 gene.^[157]^[158] TCF3 has been shown to directly enhance Hes1 (a well-known target of Notch signaling) expression.^[159]

This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. The 9aaTAD transactivation domains of E proteins and MLL are very similar and both bind to the KIX domain of general transcriptional mediator CBP.^[160]^[161] E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development.^[162]

Consensus sequence found in the promoter of TUG1 is 5'-GTCTGGT-3'.^[44]

Translational control sequences

"Maternal mRNAs are translationally regulated during early development. Zar1 and its closely related homolog, Zar2, are both crucial in early development. Xenopus laevis Zygote arrest 2 (Zar2) binds to the Translational Control Sequence (TCS) in maternal mRNAs and regulates translation."^[163]

"Putative TCSs have been identified in Wee1, PCM-1 and Mos 3′ UTRs. The TCSs are slightly different: AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) [20]".^[163]

Unfolded protein response elements

X-box binding protein 1s "XBP1s binds to the [unfolded protein response] UPR element (UPRE) containing the consensus sequence TGACGTGG/A and regulates the transcription of target genes in a cell type- and condition-specific manner (Yamamoto et al., 2004)."^[71]

The consensus sequence for UPRE is 5'-TGACGTG(G/A)-3'.^[71]

Upstream stimulating factors

"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."^[164]

"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important cis-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson et al., 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre et al., 1989)."^[164]

"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam et al., 1990a), is GCCACCGG."^[164]

"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."^[164]

A likely general USF box consensus sequence may be 5'-GCC(A/T)NN(C/G/T)(A/G)-3'.

V boxes

"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."^[134]

In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.

In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.

Vitamin D response elements

"Using the Jasper and Consite algorithms, the A/GGG/TTCAnnnA/GGG/TTCA and GA/GGTTCATnnnGTTCA sequences were considered as human and mouse VDRE consensus sequences, respectively, as previously shown.17, 18 Previous studies have suggested that regulatory VDREs could locate distally, i.e. > 1 Mb, to the transcription starting site.19 We analysed the entire genomic sequence of the human and murine HOTAIR and ANRIL genes as well as 5 kb upstream the transcription starting sites to include proximal promoter regions. Our analysis revealed two and three potential VDREs in the human HOTAIR and ANRIL genes, respectively, all of them were located within the intron 1 [...]."^[165]

W boxes

The "presence of WRKY TF binding sites (C/TTGACC/T, W boxes) in numerous co-regulated Arabidopsis defense gene promoters provided circumstantial evidence that zinc-finger-type WRKY factors play a broad and pivotal role in regulating defenses [10]."^[166]

The W box is a DNA cis-regulatory element sequence, (T)TGAC(C/T), which is recognized by the family of WRKY transcription factors.^[167]^[168]

X core promoter elements

"[T]he X gene core promoter element 1 ... is located between nucleotides -8 and +2 relative to the transcriptional start site (+1) and has a consensus sequence of G/A/T-G/C-G-T/C-G-G-G/A-A-G/C₊₁-A/C."^[169]

Xenobiotic responsive elements

The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), contains the core sequence 5'-GCGTG-3'^[170] within the consensus sequence 5'-T/GNGCGTGA/CG/CA-3'^[171]^[138] in the promoter region of AhR responsive genes. The AhR/ARNT heterodimer directly binds the AHRE/DRE/XRE core sequence in an asymmetric manner such that ARNT binds to 5'-GTG-3' and AhR binding 5'-TC/TGC-3'.^[172]^[173]^[174] Recent research suggests that a second type of element termed AHRE-II, 5'-CATG(N6)C[T/A]TG-3', is capable of indirectly acting with the AhR/ARNT complex.^[175]^[176]

Yap recognition sequences

"Saccharomyces cerevisiae contains eight members of a novel and fungus-specific family of bZIP proteins that is defined by four atypical residues on the DNA-binding surface. Two of these proteins, Yap1 and Yap2, are transcriptional activators involved in pleiotropic drug resistance. Although initially described as AP-1 factors, at least four Yap proteins bind most efficiently to TTACTAA, a sequence that differs at position ±2 from the optimal AP-1 site (TGACTCA); further, a Yap-like derivative of the AP-1 factor Gcn4 (A239Q S242F) binds efficiently to the Yap recognition sequence."^[177]

The upstream activating sequence (UAS) for Yap1p/2p is TTACTAA, which is found in genes GSH1, TRX2, YCF1, GLR1, induced by oxidative stress such as H₂O₂, for regulation of genes expressed in response to environmental changes.^[22]

YY1

YY1 consensus sequence is 5'-CCATTTA-3' and 5'-CCATCTT-3'.^[44]

Z boxes

"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of RbcS1A (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."^[24]

Z-boxes 1-3 contain 5'-AGGTG-3'.^[178]

Response element positive results

Response element negative results

Hypotheses

Downstream core promoters may work as transcription factors even as their complements or inverses.
In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.

References

↑ Francis S Collins, Eric D Green, Alan E Guttmacher, Mark S Guyer (24 April 2003). "A vision for the future of genomics research". Nature. 422 (6934): 835–47. doi:10.1038/nature01626. PMID 12695777. Retrieved 9 August 2020.
↑ The ENCODE Project Consortium (22 October 2004). "The ENCODE (ENCyclopedia of DNA Elements) Project". Science. 306 (5696): 636–640. doi:10.1126/science.1105136. PMID 15499007. Retrieved 9 August 2020.
↑ The ENCODE Project Consortium (14 June 2007). "Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project". Nature. 447 (7146): 799–816. doi:10.1038/nature05874. PMID 17571346. Retrieved 9 August 2020.
↑ Ya-Mei Wang, Ping Zhou, Li-Yong Wang, Zhen-Hua Li, Yao-Nan Zhang, and Yu-Xiang Zhang (10 August 2012). "Correlation Between DNase I Hypersensitive Site Distribution and Gene Expression in HeLa S3 Cells". PLoS One. 7 (8): e2414. doi:10.1371/journal.pone.0042414. PMID 22900019. Retrieved 9 August 2020.
↑ ^5.0 ^5.1 ^5.2 ^5.3 ^5.4 ^5.5 ^5.6 ^5.7 ^5.8 ^5.9 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
↑ ^7.0 ^7.1 ^7.2 ^7.3 ZG E, YP Z, JH Zhou and L W (16 April 2014). "Roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: punctuation (help)
↑ ^8.0 ^8.1 RefSeq (November 2019). "LOC116286197 CRISPRi-validated cis-regulatory element chr19.6329 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.
↑ RefSeq (February 2016). "ZNF582 zinc finger protein 582 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 May 2020.
↑ RefSeq (June 2018). "LOC112553117 Sharpr-MPRA regulatory region 1998 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.
↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 10473 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.
↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 7872 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 1 August 2020.
↑ RefSeq (June 2018). "Sharpr-MPRA regulatory region 9894 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.
↑ ^14.0 ^14.1 Tara L. Conforto, Yijing Zhang, Jennifer Sherman, and David J. Waxman (November 2012). "Impact of CUX2 on the Female Mouse Liver Transcriptome: Activation of Female-Biased Genes and Repression of Male-Biased Genes" (PDF). Molecular and Cellular Biology. 32 (22): 4611–4627. doi:10.1128/MCB.00886-12. PMID 22966202. Retrieved 8 August 2020.
↑ ^15.0 ^15.1 ^15.2 Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek (May 28, 2010). "Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen Assimilation in Yeast" (PDF). The Journal of Biological Chemistry. 285 (22): 16893–16911. doi:10.1074/jbc.M110.121947. Retrieved 4 January 2021. line feed character in |title= at position 104 (help)
↑ ^16.0 ^16.1 ^16.2 ^16.3 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
↑ Landschulz WH, Johnson PF, McKnight SL (June 1988). "The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins". Science. 240 (4860): 1759–64. Bibcode:1988Sci...240.1759L. doi:10.1126/science.3289117. PMID 3289117.
↑ Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.
↑ Keiko Kokoroishi, Ayumu Nakashima, Shigehiro Doi, Toshinori Ueno, Toshiki Doi, Yukio Yokoyama, Kiyomasa Honda, Masami Kanawa, Yukio Kato, Nobuoki Kohno & Takao Masaki (28 May 2015). "High glucose promotes TGF-β1 production by inducing FOS expression in human peritoneal mesothelial cells". Clinical and Experimental Nephrology. 20 (1): 30–8. doi:10.1007/s10157-015-1128-9. PMID 26018137. Retrieved 14 August 2020.
↑ ^20.0 ^20.1 ^20.2 ^20.3 ^20.4 ^20.5 ^20.6 ^20.7 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
↑ ^21.0 ^21.1 Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.
↑ ^22.00 ^22.01 ^22.02 ^22.03 ^22.04 ^22.05 ^22.06 ^22.07 ^22.08 ^22.09 ^22.10 ^22.11 ^22.12 ^22.13 ^22.14 ^22.15 ^22.16 ^22.17 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
↑ ^23.0 ^23.1 ^23.2 ^23.3 James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. doi:10.1128/mcb.19.1.567. PMID 9858580. Retrieved 5 November 2018.
↑ ^24.0 ^24.1 ^24.2 ^24.3 ^24.4 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
↑ Takayuki Murata, Chieko Noda, Yohei Narita1, Takahiro Watanabe, Masahiro Yoshida, Keiji Ashio, Yoshitaka Sato, Fumi Goshima, Teru Kanda, Hironori Yoshiyama, Tatsuya Tsurumi, and Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
↑ Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo (1 November 1993). "Structural characterization of the complete human perlecan gene and its promoter" (PDF). Proceedings of the National Academy of Sciences USA. 90 (21): 10404–10408. doi:10.1073/pnas.90.21.10404. PMID 8234307. Retrieved 6 September 2020.
↑ Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud (22 May 2020). "The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4" (PDF). Journal of Biological Chemistry. 295 (21): 7418. doi:10.1074/jbc.RA119.011864. PMID 32312748 Check |pmid= value (help). Retrieved 5 September 2020.
↑ Tala Bakheet, Bryan R. G. Williams, and Khalid S. A. Khabar (1 January 2003). "ARED 2.0: an update of AU-rich element mRNA database". Nucleic Acids Research. 31 (1): 421–423. doi:10.1093/nar/gkg023. Retrieved 23 March 2021.
↑ ^29.0 ^29.1 David A. Siegel, Olivier Le Tonqueze, Anne Biton, Noah Zaitlen, and David J. Erle (12 February 2020). "Massively Parallel Analysis of Human 3′ UTRs Reveals that AU-Rich Element Length and Registration Predict mRNA Destabilization" (PDF). bioRxiv. doi:10.1101/2020.02.12.945063. Retrieved 23 March 2021.
↑ ^30.0 ^30.1 Michael Büttner and Karam B. Singh (May 27, 1997). "Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein". Proceedings of the National Academy of Sciences of the United States of America. 94 (11): 5961–6. Retrieved 2014-05-02.
↑ S Kouhpayeh, AR Einizadeh, Z Hejazi, M Boshtam, L Shariati, M Mirian, L Darzi, M Sojoudi, H Khanahmad and A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
↑ ^32.0 ^32.1 Stephen Wilson, Jianfei Qi & Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
↑ Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara (September 1997). "Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese". Hypertension. 30 (3 Pt 1): 321–5. doi:10.1161/01.HYP.30.3.321. PMID 9314411. Retrieved 2012-02-20.
↑ Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu (28 November 1997). "Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity". The Journal of Biological Chemistry. 272 (48): 30558–62. PMID 9374551. Retrieved 2012-02-20.
↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
↑ Stephen A. Liebhaber, Michel J. Goossens, and Yuet Wai Kan (December 1980). "Cloning and complete nucleotide sequence of human 5'-α-globin gene" (PDF). Proceedings of the National Academy of Science USA. 77 (12): 7054–8. Retrieved 2013-06-28.
↑ ^37.0 ^37.1 ^37.2 ^37.3 Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy (3 June 2019). "Capturing Auxin Response Factors Syntax Using DNA Binding Models". Molecular Plant. 12 (6): 822–832. doi:10.1016/j.molp.2018.09.010. PMID 30336329. Retrieved 29 August 2020.
↑ ^38.0 ^38.1 PA Johnson, D Bunick, NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
↑ Amber Paratore Sanchez and Kumar Sharma (July 2009). "Transcription factors in the pathogenesis of diabetic nephropathy". Expert Reviews in Molecular Medicine. 11: e13. doi:10.1017/S1462399409001057. PMID 19397838. Retrieved 1 October 2018.
↑ ^40.0 ^40.1 ^40.2 Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
↑ ^41.0 ^41.1 ^41.2 Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (March 7, 2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746.
↑ Alan K. Kutach, James T. Kadonaga (July 2000). "The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in Drosophila Core Promoters" (PDF). Molecular and Cellular Biology. 20 (13): 4754–64. PMID 10848601. Retrieved 2012-07-15.
↑ ^43.0 ^43.1 ^43.2 Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler (21 April 2017). "Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator". Scientific Reports. 7: 1051. doi:10.1038/s41598-017-01031-9. PMID 28432336. Retrieved 28 August 2020.
↑ ^44.0 ^44.1 ^44.2 ^44.3 ^44.4 ^44.5 ^44.6 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
↑ ^45.0 ^45.1 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
↑ Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito (5 February 2013). "A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening". The Plant Cell. 25 (2): 371–86. doi:10.1105/tpc.112.108118. PMID 23386264. Retrieved 2017-02-19.
↑ ^47.0 ^47.1 ^47.2 ^47.3 ^47.4 Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis (19 April 2011). "FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis". Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17.
↑ ^48.0 ^48.1 Christof Berberich, Ingolf Dürr, Michael Koenen and Veit Witzemann (September 1993). "Two adjacent E box elements and a M‐CAT box are involved in the muscle‐specific regulation of the rat acetylcholine receptor β subunit gene". European Journal of Biochemistry. 216 (2): 395–404. doi:10.1111/j.1432-1033.1993.tb18157.x. Retrieved 27 December 2019.
↑ ^49.0 ^49.1 E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko (2003). "Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11" (PDF). Molecular Biology. 37 (3): 362–371. Retrieved 11 April 2019.
↑ ^50.0 ^50.1 Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). "The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization" (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.
↑ Joanna Deckert, Natasha Taranenko, and Peter M. Gresshoff (1994). Peter M. Gresshoff, ed. Cell Cycle Genes and Their Plant Homologues, In: Plant Genome Analysis: Current Topics in Plant Molecular Biology. 2000 Corporate Blvd., N.W., Boca Raton, Florida 33431: CRC Press, Inc. pp. 169–194. ISBN 0-8493-8264-5. Retrieved 19 April 2021.
↑ Wei Wei, Yang Hu, Meng-Yuan Cui, Yong-Tao Han, Kuan Gao, and Jia-Yue Feng (22 December 2016). "Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca". Frontiers in Plant Science. 7: 1937. doi:10.3389/fpls.2016.01937. PMID 28066489. Retrieved 29 November 2020.
↑ ^53.0 ^53.1 ^53.2 ^53.3 María C. Leal, Ezequiel I. Surace, María P. Holgado, Carina C. Ferrari, Rodolfo Tarelli, Fernando Pitossi, Thomas Wisniewski, Eduardo M. Castaño, and Laura Morelli (19 October 2011). "Notch signaling proteins HES-1 and Hey-1 bind to insulin degrading enzyme (IDE) proximal promoter and repress its transcription and activity: Implications for cellular Aβ metabolism". Biochim Biophys Acta. 1823 (2): 227–235. doi:10.1016/j.bbamcr.2011.09.014. PMID 22036964. Retrieved 21 March 2021.
↑ Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka (11 October 2016). "Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements". Genome Biology. 17: 209. doi:10.1186/s13059-016-1072-3. Retrieved 14 September 2020.
↑ ^55.0 ^55.1 Jeanette M. Quinn, Paola Barraco, Mats Eriksson and Sabeeha Merchant (March 2000). "Coordinate Copper- and Oxygen-responsive Cyc6 and Cpx1 Expression in Chlamydomonas Is Mediated by the Same Element". Journal of Biological Chemistry. 275 (9): 6080–6089. doi:10.1074/jbc.275.9.6080. Retrieved 1 April 2021.
↑ Yong-Sung Park, Tae-Hyoung Kim and Cheol-Won Yun (3 July 2017). "Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus". Biochemical Journal. 474 (14): 2365–2378. doi:10.1042/BCJ20170191. Retrieved 2 April 2021.
↑ Shuangcheng Ding, Fengyu He, Wenlin Tang, Hewei Du and Hongwei Wang (12 August 2019). "Identification of Maize CC-Type Glutaredoxins That Are Associated with Response to Drought Stress". Genes. 10 (610): 1–15. doi:10.3390/genes10080610. Retrieved 30 November 2020.
↑ ^58.0 ^58.1 Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman (September 1986). "Identification of a cyclic-AMP-responsive element within the rat somatostatin gene" (PDF). Proceedings of the National Academy of Sciences of the USA. 83 (18): 6382–6. PMID 2875459. Retrieved 17 September 2018.
↑ ^59.0 ^59.1 ^59.2 Mingtang Xie1, Hongyu Chen, Ling Huang, Ryan C. O’Neil1, Maxim N. Shokhirev & Joseph R. Ecker (23 April 2018). "A B-ARR-mediated cytokinin transcriptional network directs hormone cross-regulation and shoot development" (PDF). Nature Communications. 9 (1604): 1–13. doi:10.1038/s41467-018-03921-6. Retrieved 26 April 2021.
↑ Andrew C Lin, Chin Lik Tan, Chien-Ling Lin, Laure Strochlic, Yi-Shuian Huang, Joel D Richter & Christine E Holt (2 March 2009). "Cytoplasmic polyadenylation and cytoplasmic polyadenylation element-dependent mRNA regulation are involved in Xenopus retinal axon development". Neural Development. 4: 8. doi:10.1186/1749-8104-4-8. |access-date= requires |url= (help)
↑ Maria Ivshina, Paul Lasko, and Joel D. Richter (October 2014). "Cytoplasmic polyadenylation element binding proteins in development, health, and disease". Annual Review of Cell and Developmental Biology. 30: 393–415. doi:10.1146/annurev-cellbio-101011-155831. Retrieved 17 April 2021.
↑ ^62.0 ^62.1 Jun Li, Ana Carolina Dantas Machado, Ming Guo, Jared M. Sagendorf, Zhan Zhou, Longying Jiang, Xiaojuan Chen, Daichao Wu, Lingzhi Qu, Zhuchu Chen, Lin Chen, Remo Rohs, and Yongheng Chen (25 July 2017). "Structure of the forkhead domain of FOXA2 bound to a complete DNA consensus site". Biochemistry. 56 (29): 3745–3753. doi:10.1021/acs.biochem.7b00211. PMID 28644006. Retrieved 28 August 2020.
↑ ^63.0 ^63.1 ^63.2 ^63.3 ^63.4 ^63.5 Masaru Motojima, Takao Ando and Toshimasa Yoshioka (10 July 2000). "Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells" (PDF). Biomedical Journal. 349 (2): 435–441. doi:10.1042/0264-6021:3490435. PMID 10880342. Retrieved 13 August 2020.
↑ ^64.0 ^64.1 Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
↑ ^65.0 ^65.1 ^65.2 ^65.3 Dong-Hoon Lee, Naum Gershenzon, Malavika Gupta, Ilya P. Ioshikhes, Danny Reinberg and Brian A. Lewis (November 2005). "Functional Characterization of Core Promoter Elements: the Downstream Core Element Is Recognized by TAF1". Molecular and Cellular Biology. 25 (21): 9674–86. doi:10.1128/MCB.25.21.9674-9686.2005. PMID 16227614. Retrieved 2010-10-23.
↑ T.W. Burke and James T. Kadonaga (15 March 1996). "Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters" (PDF). Genes & Development. 10 (6): 711–724. doi:10.1101/gad.10.6.711. PMID 8598298.
↑ James T. Kadonaga (September 2002). "The DPE, a core promoter element for transcription by RNA polymerase II" (PDF). Experimental & Molecular Medicine. 34 (4): 259–264. PMID 12515390.
↑ Tamar Juven-Gershon, James T. Kadonaga (March 15, 2010). "Regulation of Gene Expression via the Core Promoter and the Basal Transcriptional Machinery". Developmental Biology. 339 (2): 225–9. doi:10.1016/j.ydbio.2009.08.009. PMC 2830304. PMID 19682982.
↑ Cornelis Murre and David Baltimore (1992). "The Helix-Loop-Helix Motif: Structure and Function, In: Transcriptional Regulation". 22B. Cold Spring Harbor Laboratory Press: 861–79. doi:10.1101/087969425.22B.861. Retrieved 2017-02-08.
↑ ^70.0 ^70.1 ^70.2 ^70.3 Kai Qiu, Zhongpeng Li, Zhen Yang, Junyi Chen, Shouxin Wu, Xiaoyu Zhu, Shan Gao, Jiong Gao, Guodong Ren, Benke Kuai, and Xin Zhou (July 2015). "EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis". PLoS Genetics. 11 (7): e1005399. doi:10.1371/journal.pgen.1005399. PMID 26218222. Retrieved 4 October 2020.
↑ ^71.0 ^71.1 ^71.2 Jae-Seon So (31 August 2018). "Roles of Endoplasmic Reticulum Stress in Immune Responses". Molecules and Cells. 41 (8): 705–16. doi:10.14348/molcells.2018.0241. PMID 30078231. Retrieved 5 September 2020.
↑ Jaideep Chaudhary and Michael K. Skinner (May 1999). "Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells". Molecular Endocrinology. 13 (5): 774–86. doi:10.1210/me.13.5.774. PMID 10319327. Retrieved 2013-06-14.
↑ Catherine Terraz, Gaelle Brideau, Pierre Ronco and Jérôme Rossert (May 24, 2002). "A Combination of cis-Acting Elements Is Required to Activate the Pro-α1(I) Collagen Promoter in Tendon Fibroblasts of Transgenic Mice". The Journal of Biological Chemistry. 277 (21): 19019–26. doi:10.1074/jbc.M200125200. Retrieved 2013-02-13.
↑ Montaña Mena, Francisco Javier Cejudo, Ines Isabel-Lamoneda and Pilar Carbonero (1 September 2002). "A Role for the DOF Transcription Factor BPBF in the Regulation of Gibberellin-Responsive Genes in Barley Aleurone". Plant Physiology. 130 (1): 111–9. doi:10.1104/pp.005561. Retrieved 2017-02-19.
↑ ^75.0 ^75.1 ^75.2 ^75.3 ^75.4 ^75.5 ^75.6 Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye (January 2017). "Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism" (PDF). Plant Molecular Biology. 93: 209–225. doi:10.1007/s11103-016-0557-5. PMID 27826761. Retrieved 7 May 2020.
↑ H Imataka, K Sogawa, KI Yasumoto, Y Kikuchi, K Sasano, A Kobayashi, M Hayami, and Y Fujii-Kuriyama (October 1992). "Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene" (PDF). The EMBO Journal. 11 (10): 3663–71. PMID 1356762. Retrieved 2013-01-27.
↑ Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti and Susana Correa-Garcia (12 October 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor Leu3" (PDF). Microbiology. 163: 1692–1701. doi:10.1099/mic.0.000560. Retrieved 20 April 2021.
↑ Nanbiao Long, Thomas Orasch, Shizhu Zhang, Lu Gao, Xiaoling Xu, Peter Hortschansky, Jing Ye, Fenli Zhang, Kai Xu, Fabio Gsaller, Maria Straßburger, Ulrike Binder, Thorsten Heinekamp, Axel A. Brakhage, Hubertus Haas, Ling Lu (26 October 2018). "The Zn₂Cys₆-type transcription factor LeuB cross-links regulation of leucine biosynthesis and iron acquisition in Aspergillus fumigatus". PLOS Genetics. 14 (10): e1007762. doi:10.1371/journal.pgen.1007762. Retrieved 20 April 2021.
↑ Guck T. Ooi, Kelley R. Hurst, Matthew N. Poy, Matthew M. Rechler, Yves R. Boisclair (1 May 1998). "Binding of STAT5a and STAT5b to a Single Element Resembling a γ-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells". Molecular Endocrinology. 12 (5): 675–687. doi:10.1210/mend.12.5.0115. PMID 9605930. Retrieved 9 September 2020.
↑ Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke (5 September 2019). "The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity". Nucleic Acids Research. 47 (15): 8180–8192. doi:10.1093/nar/gkz486. PMID 31147715. Retrieved 28 August 2020.
↑ Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.
↑ Niwed Kullawong, Sutipa Tanapongpipat, Lily Eurwilaichitr and Witoon Tirasophon (2018). "Unfolded Protein Response (UPR) Induced Hybrid Promoters for Heterologous Gene Expression in Pichia pastoris" (PDF). Chiang Mai Journal of Science. 45 (7): 2554–2565. Retrieved 11 January 2021.
↑ Timofey S. Rozhdestvensky, Thean Hock Tang, Inna V. Tchirkova, Jürgen Brosius, Jean‐Pierre Bachellerie and Alexander Hüttenhofer (2003). "Binding of L7Ae protein to the K‐turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea". Nucleic Acids Research. 31 (3): 869–77. doi:10.1093/nar/gkg175. Retrieved 2014-06-08.
↑ Laura C. Collopy, Tracy L. Ware, Tomas Goncalves, Sunnvør í Kongsstovu, Qian Yang, Hanna Amelina, Corinne Pinder, Ala Alenazi, Vera Moiseeva, Siân R. Pearson, Christine A. Armstrong & Kazunori Tomita (2018). "LARP7 family proteins have conserved function in telomerase assembly" (PDF). Nature Communications. 9 (557): 1–8. doi:10.1038/s41467-017-02296-4. Retrieved 1 August 2019.
↑ William P. Lindsay, Fiona M. McAlister, Qun Zhu, Xian-Zhi He, Wolfgang Dröge-Laser, Susie Hedrick, Peter Doerner, Chris Lamb and Richard A. Dixon (July 2002). "KAP-2, a protein that binds to the H-box in a bean chalcone synthase promoter, is a novel plant transcription factor with sequence identity to the large subunit of human Ku autoantigen". Plant Molecular Biology. 49 (5): 503–514. doi:10.1023/A:1015505316379. Retrieved 5 October 2019.
↑ Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon (October 1992). "Combination of H-box [CCTACC(N)₇CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate p-coumaricacid" (PDF). Proceedings of the National Academy of Sciences USA. 89 (19): 9230–9234. doi:10.1073/pnas.89.19.9230. Retrieved 16 March 2021.
↑ ^87.0 ^87.1 ^87.2 Dawn L. Eastmond and Hillary C. M. Nelson (October 27, 2006). "Genome-wide Analysis Reveals New Roles for the Activation Domains of the Saccharomyces cerevisiae Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response". Journal of Biological Chemistry. 281 (43): P32909–32921. doi:10.1074/jbc.M602454200. Retrieved 19 January 2021.
↑ Vincent Laudet, Dominique Stehelin and Hans Clevers (1993). "Ancestry and diversity of the HMG box superfamily" (PDF). Nucleic Acids Research. 21 (10): 2493–501. doi:10.1093/nar/21.10.2493. PMID 8506143. Retrieved 2017-04-05.
↑ RefSeq (April 2015). HNF1A HNF1 homeobox A [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 November 2018.
↑ ^90.0 ^90.1 Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
↑ Cissi Gardmo and Agneta Mode (1 December 2006). "In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression". Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. PMID 17170084. Retrieved 2017-09-01.
↑ Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik (June 1999). "DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4". Biochemical and Biophysical Research Communications. 259 (3): 510–518. PMID 10364449. Retrieved 6 May 2020.
↑ G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro (20 June 1994). "Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain" (PDF). Nucleic Acids Research. 22 (15): 3075–83. doi:10.1093/nar/22.15.3075. PMID 7915030. Retrieved 6 May 2020.
↑ Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger (19 December 2019). "Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression". Haematologica. 105 (12): 2774–2784. doi:10.3324/haematol.2019.236406. PMID 33256376 Check |pmid= value (help). Retrieved 6 May 2021.
↑ ^95.0 ^95.1 Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi (January 2009). "Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene". Arthritis & Rheumatism. 60 (1): 166–78. doi:10.1002/art.24243. PMID 19116917. Retrieved 2013-06-18.
↑ Hualin Xi, Yong Yu, Yutao Fu, Jonathan Foley, Anason Halees, and Zhiping Weng (June 2007). "Analysis of overrepresented motifs in human core promoters reveals dual regulatory roles of YY1". Genome Research. 17 (6): 798–806. doi:10.1101/gr.5754707. PMC 1891339. PMID 17567998.
↑ Jennifer F. Kugel and James A. Goodrich (2017). "Finding the start site: redefining the human initiator element" (PDF). Genes & Development. 31 (1–2): 1. doi:10.1101/gad.295980.117. Retrieved 9 May 2019.
↑ Sabine Schwank, Ronald Ebbert, Karin Rautenstrau𝛃, Eckhart Schweizer and Hans-Joachim Schüller (25 January 1995). "Yeast transcriptional activator IN02 interacts as an Ino2p/Ino4p basic helix-loop-helix heteromeric complex with the inositol/choline responsive element necessary for expression of phospholipid biosynthetic genes in Saccharomyces cerevisiae" (PDF). Nucleic Acids Research. 23 (2): 230–37. doi:10.1093/nar/23.2.230. Retrieved 10 August 2020.
↑ Kendall C. Case, Michael Salsaa, Wenxi Yu and Miriam L. Greenberg (28 December 2018). Gomez-Cambronero J., Frohman M., ed. Regulation of Inositol Biosynthesis: Balancing Health and Pathophysiology, In: Lipid Signaling in Human Diseases. Handbook of Experimental Pharmacology, vol 259. Cham: Springer. pp. 221–260. doi:10.1007/164_2018_181. ISBN 978-3-030-33667-7. Retrieved 29 January 2021.
↑ John M. Lopes, Jeanne P. Hirsch, Patricia A. Chorgo, Karen L. Schulze and Susan A. Henry (April 11, 1991). "Analysis of sequences in the INOl promoter that are involved in its regulation by phospholipid precursors" (PDF). Nucleic Acids Research. 19 (7): 1687–1693. doi:10.1093/nar/19.7.1687. PMID 2027776. Retrieved 29 January 2021.
↑ Mengmeng Lu, Chuanyan Yang, Meijia Li, Qilin Yi, Guangxia Lu, Yichen Wu, Chen Qu, Lingling Wang, and Linsheng Song (May 2018). "A conserved interferon regulation factor 1 (IRF-1) from Pacific oyster Crassostrea gigas functioned as an activator of IFN pathway". Fish & Shellfish Immunology. 76 (May): 68–77. doi:10.1016/j.fsi.2018.02.024. Retrieved 27 March 2021.
↑ ^102.0 ^102.1 Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka (12 February 2020). "A Krüppel-like factor 1 (KLF1) Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity". Molecular and Cellular Biology. 40 (5): e00444–19. doi:10.1128/MCB.00444-19. PMID 31818881. |access-date= requires |url= (help)
↑ ^103.0 ^103.1 ^103.2 Seungsoo Kim, Maitreya J Dunham, Jay Shendure (13 May 2019). "A combination of transcription factors mediates inducible interchromosomal contacts" (PDF). eLife. 8: e42499. doi:10.7554/eLife.42499.001. Retrieved 20 February 2021.
↑ ^104.0 ^104.1 Herman A. de Boer, Lisa J. Comstock, and Mark Vasser (January 1983). "The tac promoter: A functional hybrid derived from the trp and lac promoters" (PDF). Proceedings of the National Academy of Sciences USA. 80 (1): 21–5. Retrieved 2017-02-19.
↑ Vera M. Ripoll, Nicholas A. Meadows, Liza-Jane Raggatt, Ming K. Chang, Allison R. Pettit, Alan I. Cassady and David A. Hume (30 April 2005). "Microphthalmia transcription factor regulates the expression of the novel osteoclast factor GPNMB" (PDF). Gene. 413 (1–2): 32–41. doi:10.1016/j.gene.2008.01.014. Retrieved 18 March 2021.
↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. |access-date= requires |url= (help)
↑ Sang Yoon Lee & Yoon Kwon Nam (3 July 2017). "Molecular cloning of metal-responsive transcription factor-1 (MTF-1) and transcriptional responses to metal and heat stresses in Pacific abalone, Haliotis discus hannai". Fisheries and Aquatic Sciences. 20: 9. doi:10.1186/s41240-017-0055-y. Retrieved 16 October 2020.
↑ ^108.0 ^108.1 J. Branco, M. Ola, R. M. Silva, E. Fonseca, N. C. Gomes, C. Martins-Cruz, A. P. Silva, A. Silva-Dias, C. Pina-Vaz, C. Erraught, L. Brennan, A. G. Rodrigues, G. Butler and I. M. Miranda (August 2017). "Impact of ERG3 mutations and expression of ergosterol genes controlled by UPC2 and NDT80 in Candida parapsilosis azole resistance". Clinical Microbiology and Infection. 23 (8): 575.e1–575.e8. doi:10.1016/j.cmi.2017.02.002. PMID 28196695. Retrieved 5 September 2020.
↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
↑ Sotirios‐Spyridon Vamvakas, John Kapolos, Lambros Farmakis, Gregoria Koskorellou, Fotios Genneos (14 May 2019). "Ser625 of msn2 transcription factor is indispensable for ethanol tolerance and alcoholic fermentation process". Biotechnology Progress. 35 (5): ee2837. doi:10.1002/btpr.2837. Retrieved 6 February 2021.
↑ Amanda Charlesworth, Anna Wilczynska, Prajitha Thampi, Linda L Cox, and Angus M MacNicol (21 June 2006). "Musashi regulates the temporal order of mRNA translation during Xenopus oocyte maturation". The EMBO Journal. 25 (12): 2792–2801. doi:10.1038/sj.emboj.7601159. PMID 16763568. Retrieved 17 April 2021.
↑ Siva Arumugam Saravanaperuma, Dario Pediconi, Carlo Renieri, Antonietta La Terza (15 June 2012). "Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant". PLOS ONE. 7 (6): e38657. doi:10.1371/journal.pone.0038657. Retrieved 17 April 2021.
↑ Tomoya Kotani, Kaori Maehata, Natsumi Takei (2017). "Regulation of Translationally Repressed mRNAs in Zebrafish and Mouse Oocytes, In: Oocytes. Results and Problems in Cell Differentiation". 63. Cham: Springer: 297–324. doi:10.1007/978-3-319-60855-6_13. Retrieved 17 April 2021.
↑ Paul J Rushton and Imre E Somssich (August 1998). "Transcriptional control of plant genes responsive to pathogens" (PDF). Current Opinion in Plant Biology. 1 (4): 311–5. doi:10.1016/1369-5266(88)80052-9. PMID 10066598. Retrieved 5 November 2018.
↑ ^115.0 ^115.1 Potthoff MJ, Olson EN (December 2007). "MEF2: a central regulator of diverse developmental programs". Development. 134 (23): 4131–40. doi:10.1242/dev.008367. PMID 17959722.
↑ ^116.0 ^116.1 ^116.2 Ayisha Zia, Muhammad Imran, and Sajid Rashid (7 February 2020). "In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity". Journal of Chemical Information and Modeling. 60 (3): 1892–1909. doi:10.1021/acs.jcim.0c00008. Retrieved 10 September 2020.
↑ Nathalie Oulhen, S. Zachary Swartz, Jessica Laird, Alexandra Mascaro, Gary M. Wessel (1 February 2017). "Transient translational quiescence in primordial germ cells". Development. 144 (7): 1201. doi:10.1242/dev.144170. Retrieved 6 March 2021.
↑ Ruthrothaselvi Bharathavikru, Tatiana Dudnakova, Stuart Aitken, Joan Slight, Mara Artibani, Peter Hohenstein, David Tollervey and Nick Hastie (13 March 2017). "Transcription factor Wilms' tumor 1 regulates developmental RNAs through 3′ UTR interaction". Genes & Development. 31 (4): 347–352. doi:10.1101/gad.291500.116. Retrieved 6 March 2021.
↑ Kun Huang, Jin Li, Mikako Ito, Jun-Ichi Takeda, Bisei Ohkawara, Tomoo Ogi, Akio Masuda, and Kinji Ohno (8 September 2020). "Gene Expression Profile at the Motor Endplate of the Neuromuscular Junction of Fast-Twitch Muscle". Frontiers in Molecular Neuroscience. 13: 154–165. doi:10.3389/fnmol.2020.00154. PMID 33117128 Check |pmid= value (help). Retrieved 19 March 2021.
↑ Ge Bai, Da-Hai Yang, Peijian Chao, Heng Yao, MingLiang Fei, Yihan Zhang, Xuejun Chen, Bingguang Xiao, Feng Li, Zhen-Yu Wang, Jun Yang and He Xie (19 December 2020). "Genome-wide identification and expression analysis of NtbHLH gene family in tobacco (Nicotiana tabacum L.) and the role of NtbHLH86 in drought adaptation". Plant Diversity. 10: 4. doi:10.1016/j.pld.2020.10.004. Retrieved 19 March 2021.
↑ Min Gao, Yanxun Zhu, Jinhua Yang, Hongjing Zhang, Chenxia Cheng, Yucheng Zhang, Ran Wan, Zhangjun Fei & Xiping Wang (18 March 2019). "Identification of the grape basic helix–loop–helix transcription factor family and characterization of expression patterns in response to different stresses". Plant Growth Regulation. 88: 19–39. Retrieved 20 March 2021.
↑ Takahito Fukusumi, Theresa W. Guo, Shuling Ren, Sunny Haft, Chao Liu, Akihiro Sakai, Mizuo Ando, Yuki Saito, Sayed Sadat, and Joseph A. Califano (February 2021). "Reciprocal activation of HEY1 and NOTCH4 under SOX2 control promotes EMT in head and neck squamous cell carcinoma". International Journal of Oncology. 58 (2): 226–237. doi:10.3892/ijo.2020.5156. PMID 33491747 Check |pmid= value (help). Retrieved 21 March 2021.
↑ Margaret E Katz and Sarah Cooper (1 December 2015). "Extreme Diversity in the Regulation of Ndt80-Like Transcription Factors in Fungi". G3 Genes. 5 (12): 2783–2792. doi:10.1534/g3.115.021378. Retrieved 8 February 2021. Text "Genomes" ignored (help); Text "Genetics " ignored (help)
↑ Xu L, Ajimura M, Padmore R, Klein C, Kleckner N (December 1995). "NDT80, a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae". Molecular and Cellular Biology. 15 (12): 6572–81. doi:10.1128/MCB.15.12.6572. PMC 230910. PMID 8524222.
↑ Lamoureux JS, Stuart D, Tsang R, Wu C, Glover JN (November 2002). "Structure of the sporulation-specific transcription factor Ndt80 bound to DNA". The EMBO Journal. 21 (21): 5721–32. doi:10.1093/emboj/cdf572. PMC 131069. PMID 12411490.
↑ Hendrickson WA, Ward KB (October 1975). "Atomic models for the polypeptide backbones of myohemerythrin and hemerythrin". Biochemical and Biophysical Research Communications. 66 (4): 1349–56. doi:10.1016/0006-291x(75)90508-2. PMID 5.
↑ Shelley Chu and Ira Herskowitz (April 1, 1998). "Gametogenesis in Yeast Is Regulated by a Transcriptional Cascade Dependent on Ndt80". Molecular Cell. 1 (5): 685–96. doi:10.1016/S1097-2765(00)80068-4. PMID 9660952.
↑ Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao (24 February 1995). "A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region" (PDF). Journal of Biological Chemistry. 270 (8): 4138–4145. doi:10.1074/jbc.270.8.4138. PMID 7876165. Retrieved 15 August 2020.
↑ Blomquist P, Belikov S, Wrange O (January 1999). "Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure". Nucleic Acids Research. 27 (2): 517–25. doi:10.1093/nar/27.2.517. PMC 148209. PMID 9862974.
↑ Walter F. Boron (2003). Medical Physiology: A Cellular And Molecular Approach. Elsevier/Saunders. pp. 125–126. ISBN 1-4160-2328-3.
↑ ^131.0 ^131.1 D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor (May 2016). "Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid". Journal of Dairy Science. 99 (5): 3945–3957. doi:10.3168/jds.2015-10601. PMID 26947306. Retrieved 5 September 2020.
↑ Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
↑ Sinéad Kearns, Rudi Lurz, Elena V. Orlova, Andrei L. Okorokov (27 July 2016). "Two p53 tetramers bind one consensus DNA response element". Nucleic Acid Research. 44 (13): 6185–6199. doi:10.1093/nar/gkw215. Retrieved 6 October 2020.
↑ ^134.0 ^134.1 Wangjie Yu and Paul E. Hardin (2006). "Circadian oscillators of Drosophila and mammals". Journal of Cell Science. 119: 4793–5. doi:10.1242/jcs.03174. PMID 17130292. Retrieved 2017-02-19.
↑ Elnaz Ghotbi, Kristina Lackey, Vicki Wong, Katie T. Thompson, Evan G. Caston, Minna Haddadi, Judith Benes and Richard S. Jones (1 March 2020). "Differential Contributions of DNA-Binding Proteins to Polycomb Response Element Activity at the Drosophila giant Gene" (PDF). Genetics. 214 (3): 623–634. doi:10.1534/genetics.119.302981. PMID 31919108. Retrieved 7 September 2020.
↑ Veronica Ruta, Chiara Longo, Andrea Lepri, Veronica De Angelis, Sara Occhigrossi, Paolo Costantino and Paola Vittorioso (8 February 2020). "The DOF Transcription Factors in Seed and Seedling Development". Plants. 9 (2): 218. doi:10.3390/plants9020218. Retrieved 7 January 2021.
↑ ^137.0 ^137.1 ^137.2 M. Abiramavalli and B. Usha (7 July 2020). "Identification, characterization and expression analysis of sucrose transporters in the model plant Nicotiana tabacum cv.petit havana" (PDF). Journal of Environmental Biology. 41: 803–811. doi:10.22438/jeb/41/4/MRN-1233. Retrieved 7 January 2021.
↑ ^138.0 ^138.1 Yao EF, Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
↑ Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses (November 15, 1991). "Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor β1 and by the retinoblastoma gene product" (PDF). Proceedings of the National Academy of Sciences USA. 88 (22): 10227–10231. doi:10.1073/pnas.88.22.10227. PMID 1946442. Retrieved 5 December 2018.
↑ ^140.0 ^140.1 ^140.2 ^140.3 ^140.4 Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.
↑ Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq (9 August 2016). "A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome". Frontiers in Human Neuroscience. 10: 403. doi:10.3389/fnhum.2016.00403. PMID 27555815. Retrieved 7 September 2020.
↑ ^142.0 ^142.1 ^142.2 Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.
↑ Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen (May 2016). "ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer". Nature Medicine. 22 (5): 488–496. doi:10.1038/nm.4070. PMID 27019329. Retrieved 6 September 2020.
↑ Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar (January 2005). "Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes" (PDF). Plant Molecular Biology. 57 (2): 155–171. doi:10.1007/s11103-004-6910-0. PMID 15821875. Retrieved 10 November 2018.
↑ ^145.0 ^145.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
↑ John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting (October 1990). "X-box-binding proteins positively and negatively regulate transcription of the HLA-DRA gene through interaction with discrete upstream W and V elements" (PDF). Proceedings of the National Academy of Sciences USA. 87 (19): 7703–7707. doi:10.1073/pnas.87.19.7703. PMID 2120707. Retrieved 20 August 2020.
↑ ^147.0 ^147.1 Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish (June 2001). "The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds In Vitro to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes" (PDF). Journal of Interferon and Cytokine Research. 21 (6): 379–388. doi:10.1089/107999001750277. PMID 11440635. Retrieved 15 August 2020.
↑ Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen (31 March 2007). "STAT activation and differential complex formation dictate selectivity of interferon responses". Acta Biochimica Polonica. 54 (1): 27–38. doi:10.18388/abp.2007_3266. PMID 17351669. Retrieved 15 August 2020.
↑ Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto (31 January 2013). "Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF". PLoS ONE. 8 (1): e53848. doi:10.1371/journal.pone.0053848. PMID 23382855. Retrieved 12 November 2018.
↑ Francisco Rivero (June 2002). "mRNA processing in Dictyostelium: sequence requirements for termination and splicing" (PDF). Protist. 153 (2): 169–76. doi:10.1078/1434-4610-00095. PMID 12125758. Retrieved 2017-04-05.
↑ Rodrigo Nunes da Fonseca and Thiago M. Venancio (1 March 2018). "Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda". Plos Genetics. 14 (3): e1007201. doi:10.1371/journal.pgen.1007201. PMID 29494591. Retrieved 5 September 2020.
↑ Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith (2001). "Determinants of T box protein specificity" (PDF). Development. 128 (19): 3749–3758. PMID 11585801. Retrieved 17 November 2018.
↑ Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko (25 October 2016). "Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites". Proceedings of the National Academy of Sciences of the USA. 113 (43): E6572–E6581. doi:10.1073/pnas.1613914113. PMID 27791029. Retrieved 28 August 2020.
↑ ^154.0 ^154.1 Anja Schweizer, Steffen Rupp, Brad N. Taylor, Martin Röllinghoff, Klaus Schröppel (November 2000). "The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in Candida albicans". Molecular Microbiology. 38 (3): 435–445. doi:10.1046/j.1365-2958.2000.02132.x. Retrieved 21 April 2021.
↑ Yoshiro Maru (2016). Basic Research, In: "Inflammation and Metastasis". Tokyo: Springer. pp. 193–231. doi:10.1007/978-4-431-56024-1_10. ISBN 978-4-431-56022-7. Retrieved 28 August 2020.
↑ Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford (1 September 2017). "Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation". Endocrinology. 158 (9): 3067–3078. doi:10.1210/en.2017-00314. PMID 28911178. Retrieved 5 September 2020.
↑ Henthorn P, McCarrick-Walmsley R, Kadesch T (February 1990). "Sequence of the cDNA encoding ITF-1, a positive-acting transcription factor". Nucleic Acids Research. 18 (3): 677. doi:10.1093/nar/18.3.677. PMID 2308859.
↑ Kamps MP, Murre C, Sun XH, Baltimore D (February 1990). "A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL". Cell. 60 (4): 547–55. doi:10.1016/0092-8674(90)90658-2. PMID 1967983.
↑ E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment
↑ Piskacek S (2007). "Nine-amino-acid transactivation domain: Establishment and prediction utilities". Genomics. 89 (6): 756–768. doi:10.1016/j.ygeno.2007.02.003. PMID 17467953.
↑ Piskacek, Martin; Vasku, A; Hajek, R; Knight, A (2015). "Shared structural features of the 9aaTAD family in complex with CBP". Mol. Biosyst. 11 (3): 844–851. doi:10.1039/c4mb00672k. PMID 25564305.
↑ RefSeq (September 2011). "TCF3 transcription factor 3 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 November 2020.
↑ ^163.0 ^163.1 Tomomi M. Yamamoto, Jonathan M. Cook, Cassandra V. Kotter, Terry Khat, Kevin D. Silva, Michael Ferreyros, Justin W. Holt, Jefferson D. Knight, and Amanda Charlesworth (October 2013). "Zar1 represses translation in Xenopus oocytes and binds to the TCS in maternal mRNAs with different characteristics than Zar2". Biochim Biophys Acta. 1829 (10): 1034–46. doi:10.1016/j.bbagrm.2013.06.001. PMID 23827238. Retrieved 19 April 2021.
↑ ^164.0 ^164.1 ^164.2 ^164.3 Martin L. Read, Andrew R. Clark and Kevin Docherty (1993). "The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer" (PDF). Biochemical Journal. 295: 233–237. doi:10.1042/bj2950233. PMID 8216223. Retrieved 14 August 2020.
↑ Majid Pahlevan Kakhki, Abbas Nikravesh, Zeinab Shirvani Farsani, Mohammad Ali Sahraian, Mehrdad Behmanesh (April 2018). "HOTAIR but not ANRIL long non‐coding RNA contributes to the pathogenesis of multiple sclerosis". Immunology. 153 (4): 479–487. doi:10.1111/imm.12850. Retrieved 8 March 2021.
↑ Thomas Eulgem and Imre E Somssich (2007). "Networks of WRKY transcription factors in defense signaling" (PDF). Current Opinion in Plant Biology. 10: 366–371. doi:10.1016/j.pbi.2007.04.020. Retrieved 17 October 2018.
↑ Rushton, Paul; Macdonald, H.; Huttly, A.K.; Lazarus, C.M.; Hooley, R (1995). "Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes". Plant Molecular Biology. 29: 691–702. doi:10.1007/bf00041160. PMID 8541496.
↑ Rushton PJ, Somssich IE, Ringler P, Shen QJ (May 2010). "WRKY transcription factors". Trends Plant Science. 15 (5): 247–58. doi:10.1016/j.tplants.2010.02.006. PMID 20304701.
↑ Yumiko Tokusumi, Ying Ma, Xianzhou Song, Raymond H. Jacobson, and Shinako Takada (March 2007). "The New Core Promoter Element XCPE1 (X Core Promoter Element 1) Directs Activator-, Mediator-, and TATA-Binding Protein-Dependent but TFIID-Independent RNA Polymerase II Transcription from TATA-Less Promoters". Molecular and Cellular Biology. 27 (5): 1844–58. doi:10.1128/MCB.01363-06. PMID 17210644. Retrieved 2013-02-09.
↑ Shen ES, Whitlock JP (April 1992). "Protein-DNA interactions at a dioxin-responsive enhancer. Mutational analysis of the DNA-binding site for the liganded Ah receptor". The Journal of Biological Chemistry. 267 (10): 6815–9. PMID 1313023.
↑ Lusska A, Shen E, Whitlock JP (March 1993). "Protein-DNA interactions at a dioxin-responsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded Ah receptor". The Journal of Biological Chemistry. 268 (9): 6575–80. PMID 8384216.
↑ Wharton KA, Franks RG, Kasai Y, Crews ST (December 1994). "Control of CNS midline transcription by asymmetric E-box-like elements: similarity to xenobiotic responsive regulation". Development. 120 (12): 3563–9. PMID 7821222.
↑ Bacsi SG, Reisz-Porszasz S, Hankinson O (March 1995). "Orientation of the heterodimeric aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence". Molecular Pharmacology. 47 (3): 432–8. PMID 7700240.
↑ Swanson HI, Chan WK, Bradfield CA (November 1995). "DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins". The Journal of Biological Chemistry. 270 (44): 26292–302. doi:10.1074/jbc.270.44.26292. PMID 7592839.
↑ Boutros PC, Moffat ID, Franc MA, Tijet N, Tuomisto J, Pohjanvirta R, Okey AB (August 2004). "Dioxin-responsive AHRE-II gene battery: identification by phylogenetic footprinting". Biochemical and Biophysical Research Communications. 321 (3): 707–15. doi:10.1016/j.bbrc.2004.06.177. PMID 15358164.
↑ Sogawa K, Numayama-Tsuruta K, Takahashi T, Matsushita N, Miura C, Nikawa J, Gotoh O, Kikuchi Y, Fujii-Kuriyama Y (June 2004). "A novel induction mechanism of the rat CYP1A2 gene mediated by Ah receptor-Arnt heterodimer". Biochemical and Biophysical Research Communications. 318 (3): 746–55. doi:10.1016/j.bbrc.2004.04.090. PMID 15144902.
↑ Lisete Fernandes, Claudina Rodrigues-Pousada, Kevin Struhl (December 1997). "Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions". Molecular and Cellular Biology. 17 (12): 6982–6993. doi:10.1128/MCB.17.12.6982. Retrieved 11 March 2021.
↑ Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky (November 2007). "Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition". Molecular Biology of the Cell. 18 (11): 4615–4624. doi:10.1091/mbc.e07-05-0406. PMID 17855508. Retrieved 15 November 2018.

External links

{{Phosphate biochemistry}}

[Collins-1] Francis S Collins, Eric D Green, Alan E Guttmacher, Mark S Guyer (24 April 2003). "A vision for the future of genomics research". Nature. 422 (6934): 835–47. doi:10.1038/nature01626. PMID 12695777. Retrieved 9 August 2020.

[ENCODE-2] The ENCODE Project Consortium (22 October 2004). "The ENCODE (ENCyclopedia of DNA Elements) Project". Science. 306 (5696): 636–640. doi:10.1126/science.1105136. PMID 15499007. Retrieved 9 August 2020.

[ENCODE1-3] The ENCODE Project Consortium (14 June 2007). "Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project". Nature. 447 (7146): 799–816. doi:10.1038/nature05874. PMID 17571346. Retrieved 9 August 2020.

[Wang-4] Ya-Mei Wang, Ping Zhou, Li-Yong Wang, Zhen-Hua Li, Yao-Nan Zhang, and Yu-Xiang Zhang (10 August 2012). "Correlation Between DNase I Hypersensitive Site Distribution and Gene Expression in HeLa S3 Cells". PLoS One. 7 (8): e2414. doi:10.1371/journal.pone.0042414. PMID 22900019. Retrieved 9 August 2020.

[Rossi-5] 5.0 ^5.1 ^5.2 ^5.3 ^5.4 ^5.5 ^5.6 ^5.7 ^5.8 ^5.9 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.

[MeSHD020218-6] MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.

[Zhang2014-7] 7.0 ^7.1 ^7.2 ^7.3 ZG E, YP Z, JH Zhou and L W (16 April 2014). "Roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: punctuation (help)

[RefSeq116286197-8] 8.0 ^8.1 RefSeq (November 2019). "LOC116286197 CRISPRi-validated cis-regulatory element chr19.6329 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.

[RefSeq147948-9] RefSeq (February 2016). "ZNF582 zinc finger protein 582 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 May 2020.

[RefSeq112553117-10] RefSeq (June 2018). "LOC112553117 Sharpr-MPRA regulatory region 1998 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 25 July 2020.

[RefSeq112553119-11] RefSeq (June 2018). "Sharpr-MPRA regulatory region 10473 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.

[RefSeq112577453-12] RefSeq (June 2018). "Sharpr-MPRA regulatory region 7872 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 1 August 2020.

[RefSeq112577454-13] RefSeq (June 2018). "Sharpr-MPRA regulatory region 9894 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 16 July 2020.

[Conforto-14] 14.0 ^14.1 Tara L. Conforto, Yijing Zhang, Jennifer Sherman, and David J. Waxman (November 2012). "Impact of CUX2 on the Female Mouse Liver Transcriptome: Activation of Female-Biased Genes and Repression of Male-Biased Genes" (PDF). Molecular and Cellular Biology. 32 (22): 4611–4627. doi:10.1128/MCB.00886-12. PMID 22966202. Retrieved 8 August 2020.

[Staschke-15] 15.0 ^15.1 ^15.2 Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek (May 28, 2010). "Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen Assimilation in Yeast" (PDF). The Journal of Biological Chemistry. 285 (22): 16893–16911. doi:10.1074/jbc.M110.121947. Retrieved 4 January 2021. line feed character in |title= at position 104 (help)

[Watanabe-16] 16.0 ^16.1 ^16.2 ^16.3 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.

[Landschulz-17] Landschulz WH, Johnson PF, McKnight SL (June 1988). "The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins". Science. 240 (4860): 1759–64. Bibcode:1988Sci...240.1759L. doi:10.1126/science.3289117. PMID 3289117.

[Nijhawan-18] Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.

[Kokoroishi-19] Keiko Kokoroishi, Ayumu Nakashima, Shigehiro Doi, Toshinori Ueno, Toshiki Doi, Yukio Yokoyama, Kiyomasa Honda, Masami Kanawa, Yukio Kato, Nobuoki Kohno & Takao Masaki (28 May 2015). "High glucose promotes TGF-β1 production by inducing FOS expression in human peritoneal mesothelial cells". Clinical and Experimental Nephrology. 20 (1): 30–8. doi:10.1007/s10157-015-1128-9. PMID 26018137. Retrieved 14 August 2020.

[Sharma-20] 20.0 ^20.1 ^20.2 ^20.3 ^20.4 ^20.5 ^20.6 ^20.7 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.

[Shao-21] 21.0 ^21.1 Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.

[Tang-22] 22.00 ^22.01 ^22.02 ^22.03 ^22.04 ^22.05 ^22.06 ^22.07 ^22.08 ^22.09 ^22.10 ^22.11 ^22.12 ^22.13 ^22.14 ^22.15 ^22.16 ^22.17 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

[Mitchell-23] 23.0 ^23.1 ^23.2 ^23.3 James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. doi:10.1128/mcb.19.1.567. PMID 9858580. Retrieved 5 November 2018.

[Song-24] 24.0 ^24.1 ^24.2 ^24.3 ^24.4 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.

[Murata-25] Takayuki Murata, Chieko Noda, Yohei Narita1, Takahiro Watanabe, Masahiro Yoshida, Keiji Ashio, Yoshitaka Sato, Fumi Goshima, Teru Kanda, Hironori Yoshiyama, Tatsuya Tsurumi, and Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.

[Cohen-26] Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo (1 November 1993). "Structural characterization of the complete human perlecan gene and its promoter" (PDF). Proceedings of the National Academy of Sciences USA. 90 (21): 10404–10408. doi:10.1073/pnas.90.21.10404. PMID 8234307. Retrieved 6 September 2020.

[Burton-27] Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud (22 May 2020). "The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4" (PDF). Journal of Biological Chemistry. 295 (21): 7418. doi:10.1074/jbc.RA119.011864. PMID 32312748 Check |pmid= value (help). Retrieved 5 September 2020.

[Bakheet-28] Tala Bakheet, Bryan R. G. Williams, and Khalid S. A. Khabar (1 January 2003). "ARED 2.0: an update of AU-rich element mRNA database". Nucleic Acids Research. 31 (1): 421–423. doi:10.1093/nar/gkg023. Retrieved 23 March 2021.

[Siegel-29] 29.0 ^29.1 David A. Siegel, Olivier Le Tonqueze, Anne Biton, Noah Zaitlen, and David J. Erle (12 February 2020). "Massively Parallel Analysis of Human 3′ UTRs Reveals that AU-Rich Element Length and Registration Predict mRNA Destabilization" (PDF). bioRxiv. doi:10.1101/2020.02.12.945063. Retrieved 23 March 2021.

[Buttner-30] 30.0 ^30.1 Michael Büttner and Karam B. Singh (May 27, 1997). "Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein". Proceedings of the National Academy of Sciences of the United States of America. 94 (11): 5961–6. Retrieved 2014-05-02.

[Kouhpayeh-31] S Kouhpayeh, AR Einizadeh, Z Hejazi, M Boshtam, L Shariati, M Mirian, L Darzi, M Sojoudi, H Khanahmad and A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.

[Wilson-32] 32.0 ^32.1 Stephen Wilson, Jianfei Qi & Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.

[NSato-33] Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara (September 1997). "Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese". Hypertension. 30 (3 Pt 1): 321–5. doi:10.1161/01.HYP.30.3.321. PMID 9314411. Retrieved 2012-02-20.

[Yanai-34] Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu (28 November 1997). "Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity". The Journal of Biological Chemistry. 272 (48): 30558–62. PMID 9374551. Retrieved 2012-02-20.

[Lacher-35] Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.

[Liebhaber-36] Stephen A. Liebhaber, Michel J. Goossens, and Yuet Wai Kan (December 1980). "Cloning and complete nucleotide sequence of human 5'-α-globin gene" (PDF). Proceedings of the National Academy of Science USA. 77 (12): 7054–8. Retrieved 2013-06-28.

[Stigliani-37] 37.0 ^37.1 ^37.2 ^37.3 Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy (3 June 2019). "Capturing Auxin Response Factors Syntax Using DNA Binding Models". Molecular Plant. 12 (6): 822–832. doi:10.1016/j.molp.2018.09.010. PMID 30336329. Retrieved 29 August 2020.

[Johnson-38] 38.0 ^38.1 PA Johnson, D Bunick, NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.

[Paratore-39] Amber Paratore Sanchez and Kumar Sharma (July 2009). "Transcription factors in the pathogenesis of diabetic nephropathy". Expert Reviews in Molecular Medicine. 11: e13. doi:10.1017/S1462399409001057. PMID 19397838. Retrieved 1 October 2018.

[Matsumoto-40] 40.0 ^40.1 ^40.2 Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.

[Yang-41] 41.0 ^41.1 ^41.2 Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (March 7, 2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746.

[Kutach-42] Alan K. Kutach, James T. Kadonaga (July 2000). "The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in Drosophila Core Promoters" (PDF). Molecular and Cellular Biology. 20 (13): 4754–64. PMID 10848601. Retrieved 2012-07-15.

[Schlundt-43] 43.0 ^43.1 ^43.2 Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler (21 April 2017). "Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator". Scientific Reports. 7: 1051. doi:10.1038/s41598-017-01031-9. PMID 28432336. Retrieved 28 August 2020.

[Long2020-44] 44.0 ^44.1 ^44.2 ^44.3 ^44.4 ^44.5 ^44.6 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.

[Fan-45] 45.0 ^45.1 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.

[Fujisawa-46] Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito (5 February 2013). "A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening". The Plant Cell. 25 (2): 371–86. doi:10.1105/tpc.112.108118. PMID 23386264. Retrieved 2017-02-19.

[Deng-47] 47.0 ^47.1 ^47.2 ^47.3 ^47.4 Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis (19 April 2011). "FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis". Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17.

[Berberich-48] 48.0 ^48.1 Christof Berberich, Ingolf Dürr, Michael Koenen and Veit Witzemann (September 1993). "Two adjacent E box elements and a M‐CAT box are involved in the muscle‐specific regulation of the rat acetylcholine receptor β subunit gene". European Journal of Biochemistry. 216 (2): 395–404. doi:10.1111/j.1432-1033.1993.tb18157.x. Retrieved 27 December 2019.

[Voronina-49] 49.0 ^49.1 E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko (2003). "Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11" (PDF). Molecular Biology. 37 (3): 362–371. Retrieved 11 April 2019.

[Samarsky-50] 50.0 ^50.1 Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). "The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization" (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.

[Deckert-51] Joanna Deckert, Natasha Taranenko, and Peter M. Gresshoff (1994). Peter M. Gresshoff, ed. Cell Cycle Genes and Their Plant Homologues, In: Plant Genome Analysis: Current Topics in Plant Molecular Biology. 2000 Corporate Blvd., N.W., Boca Raton, Florida 33431: CRC Press, Inc. pp. 169–194. ISBN 0-8493-8264-5. Retrieved 19 April 2021.

[Wei-52] Wei Wei, Yang Hu, Meng-Yuan Cui, Yong-Tao Han, Kuan Gao, and Jia-Yue Feng (22 December 2016). "Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca". Frontiers in Plant Science. 7: 1937. doi:10.3389/fpls.2016.01937. PMID 28066489. Retrieved 29 November 2020.

[Leal-53] 53.0 ^53.1 ^53.2 ^53.3 María C. Leal, Ezequiel I. Surace, María P. Holgado, Carina C. Ferrari, Rodolfo Tarelli, Fernando Pitossi, Thomas Wisniewski, Eduardo M. Castaño, and Laura Morelli (19 October 2011). "Notch signaling proteins HES-1 and Hey-1 bind to insulin degrading enzyme (IDE) proximal promoter and repress its transcription and activity: Implications for cellular Aβ metabolism". Biochim Biophys Acta. 1823 (2): 227–235. doi:10.1016/j.bbamcr.2011.09.014. PMID 22036964. Retrieved 21 March 2021.

[Pietzenuk-54] Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka (11 October 2016). "Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements". Genome Biology. 17: 209. doi:10.1186/s13059-016-1072-3. Retrieved 14 September 2020.

[Quinn-55] 55.0 ^55.1 Jeanette M. Quinn, Paola Barraco, Mats Eriksson and Sabeeha Merchant (March 2000). "Coordinate Copper- and Oxygen-responsive Cyc6 and Cpx1 Expression in Chlamydomonas Is Mediated by the Same Element". Journal of Biological Chemistry. 275 (9): 6080–6089. doi:10.1074/jbc.275.9.6080. Retrieved 1 April 2021.

[Park-56] Yong-Sung Park, Tae-Hyoung Kim and Cheol-Won Yun (3 July 2017). "Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus". Biochemical Journal. 474 (14): 2365–2378. doi:10.1042/BCJ20170191. Retrieved 2 April 2021.

[Ding-57] Shuangcheng Ding, Fengyu He, Wenlin Tang, Hewei Du and Hongwei Wang (12 August 2019). "Identification of Maize CC-Type Glutaredoxins That Are Associated with Response to Drought Stress". Genes. 10 (610): 1–15. doi:10.3390/genes10080610. Retrieved 30 November 2020.

[Montminy-58] 58.0 ^58.1 Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman (September 1986). "Identification of a cyclic-AMP-responsive element within the rat somatostatin gene" (PDF). Proceedings of the National Academy of Sciences of the USA. 83 (18): 6382–6. PMID 2875459. Retrieved 17 September 2018.

[Xiel-59] 59.0 ^59.1 ^59.2 Mingtang Xie1, Hongyu Chen, Ling Huang, Ryan C. O’Neil1, Maxim N. Shokhirev & Joseph R. Ecker (23 April 2018). "A B-ARR-mediated cytokinin transcriptional network directs hormone cross-regulation and shoot development" (PDF). Nature Communications. 9 (1604): 1–13. doi:10.1038/s41467-018-03921-6. Retrieved 26 April 2021.

[Lin-60] Andrew C Lin, Chin Lik Tan, Chien-Ling Lin, Laure Strochlic, Yi-Shuian Huang, Joel D Richter & Christine E Holt (2 March 2009). "Cytoplasmic polyadenylation and cytoplasmic polyadenylation element-dependent mRNA regulation are involved in Xenopus retinal axon development". Neural Development. 4: 8. doi:10.1186/1749-8104-4-8. |access-date= requires |url= (help)

[Ivshina-61] Maria Ivshina, Paul Lasko, and Joel D. Richter (October 2014). "Cytoplasmic polyadenylation element binding proteins in development, health, and disease". Annual Review of Cell and Developmental Biology. 30: 393–415. doi:10.1146/annurev-cellbio-101011-155831. Retrieved 17 April 2021.

[Li2017-62] 62.0 ^62.1 Jun Li, Ana Carolina Dantas Machado, Ming Guo, Jared M. Sagendorf, Zhan Zhou, Longying Jiang, Xiaojuan Chen, Daichao Wu, Lingzhi Qu, Zhuchu Chen, Lin Chen, Remo Rohs, and Yongheng Chen (25 July 2017). "Structure of the forkhead domain of FOXA2 bound to a complete DNA consensus site". Biochemistry. 56 (29): 3745–3753. doi:10.1021/acs.biochem.7b00211. PMID 28644006. Retrieved 28 August 2020.

[Motojima-63] 63.0 ^63.1 ^63.2 ^63.3 ^63.4 ^63.5 Masaru Motojima, Takao Ando and Toshimasa Yoshioka (10 July 2000). "Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells" (PDF). Biomedical Journal. 349 (2): 435–441. doi:10.1042/0264-6021:3490435. PMID 10880342. Retrieved 13 August 2020.

[Sumrada-64] 64.0 ^64.1 Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.

[Lee-65] 65.0 ^65.1 ^65.2 ^65.3 Dong-Hoon Lee, Naum Gershenzon, Malavika Gupta, Ilya P. Ioshikhes, Danny Reinberg and Brian A. Lewis (November 2005). "Functional Characterization of Core Promoter Elements: the Downstream Core Element Is Recognized by TAF1". Molecular and Cellular Biology. 25 (21): 9674–86. doi:10.1128/MCB.25.21.9674-9686.2005. PMID 16227614. Retrieved 2010-10-23.

[Burke1996-66] T.W. Burke and James T. Kadonaga (15 March 1996). "Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters" (PDF). Genes & Development. 10 (6): 711–724. doi:10.1101/gad.10.6.711. PMID 8598298.

[Kadonaga2002-67] James T. Kadonaga (September 2002). "The DPE, a core promoter element for transcription by RNA polymerase II" (PDF). Experimental & Molecular Medicine. 34 (4): 259–264. PMID 12515390.

[Juven-Gershon2010-68] Tamar Juven-Gershon, James T. Kadonaga (March 15, 2010). "Regulation of Gene Expression via the Core Promoter and the Basal Transcriptional Machinery". Developmental Biology. 339 (2): 225–9. doi:10.1016/j.ydbio.2009.08.009. PMC 2830304. PMID 19682982.

[Murre-69] Cornelis Murre and David Baltimore (1992). "The Helix-Loop-Helix Motif: Structure and Function, In: Transcriptional Regulation". 22B. Cold Spring Harbor Laboratory Press: 861–79. doi:10.1101/087969425.22B.861. Retrieved 2017-02-08.

[Qiu-70] 70.0 ^70.1 ^70.2 ^70.3 Kai Qiu, Zhongpeng Li, Zhen Yang, Junyi Chen, Shouxin Wu, Xiaoyu Zhu, Shan Gao, Jiong Gao, Guodong Ren, Benke Kuai, and Xin Zhou (July 2015). "EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis". PLoS Genetics. 11 (7): e1005399. doi:10.1371/journal.pgen.1005399. PMID 26218222. Retrieved 4 October 2020.

[So-71] 71.0 ^71.1 ^71.2 Jae-Seon So (31 August 2018). "Roles of Endoplasmic Reticulum Stress in Immune Responses". Molecules and Cells. 41 (8): 705–16. doi:10.14348/molcells.2018.0241. PMID 30078231. Retrieved 5 September 2020.

[Chaudhary-72] Jaideep Chaudhary and Michael K. Skinner (May 1999). "Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells". Molecular Endocrinology. 13 (5): 774–86. doi:10.1210/me.13.5.774. PMID 10319327. Retrieved 2013-06-14.

[Terraz-73] Catherine Terraz, Gaelle Brideau, Pierre Ronco and Jérôme Rossert (May 24, 2002). "A Combination of cis-Acting Elements Is Required to Activate the Pro-α1(I) Collagen Promoter in Tendon Fibroblasts of Transgenic Mice". The Journal of Biological Chemistry. 277 (21): 19019–26. doi:10.1074/jbc.M200125200. Retrieved 2013-02-13.

[Mena-74] Montaña Mena, Francisco Javier Cejudo, Ines Isabel-Lamoneda and Pilar Carbonero (1 September 2002). "A Role for the DOF Transcription Factor BPBF in the Regulation of Gibberellin-Responsive Genes in Barley Aleurone". Plant Physiology. 130 (1): 111–9. doi:10.1104/pp.005561. Retrieved 2017-02-19.

[Ye-75] 75.0 ^75.1 ^75.2 ^75.3 ^75.4 ^75.5 ^75.6 Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye (January 2017). "Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism" (PDF). Plant Molecular Biology. 93: 209–225. doi:10.1007/s11103-016-0557-5. PMID 27826761. Retrieved 7 May 2020.

[Imataka-76] H Imataka, K Sogawa, KI Yasumoto, Y Kikuchi, K Sasano, A Kobayashi, M Hayami, and Y Fujii-Kuriyama (October 1992). "Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene" (PDF). The EMBO Journal. 11 (10): 3663–71. PMID 1356762. Retrieved 2013-01-27.

[Ruiz-77] Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti and Susana Correa-Garcia (12 October 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor Leu3" (PDF). Microbiology. 163: 1692–1701. doi:10.1099/mic.0.000560. Retrieved 20 April 2021.

[Long2018-78] Nanbiao Long, Thomas Orasch, Shizhu Zhang, Lu Gao, Xiaoling Xu, Peter Hortschansky, Jing Ye, Fenli Zhang, Kai Xu, Fabio Gsaller, Maria Straßburger, Ulrike Binder, Thorsten Heinekamp, Axel A. Brakhage, Hubertus Haas, Ling Lu (26 October 2018). "The Zn₂Cys₆-type transcription factor LeuB cross-links regulation of leucine biosynthesis and iron acquisition in Aspergillus fumigatus". PLOS Genetics. 14 (10): e1007762. doi:10.1371/journal.pgen.1007762. Retrieved 20 April 2021.

[Ooi-79] Guck T. Ooi, Kelley R. Hurst, Matthew N. Poy, Matthew M. Rechler, Yves R. Boisclair (1 May 1998). "Binding of STAT5a and STAT5b to a Single Element Resembling a γ-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells". Molecular Endocrinology. 12 (5): 675–687. doi:10.1210/mend.12.5.0115. PMID 9605930. Retrieved 9 September 2020.

[Parsonnet-80] Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke (5 September 2019). "The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity". Nucleic Acids Research. 47 (15): 8180–8192. doi:10.1093/nar/gkz486. PMID 31147715. Retrieved 28 August 2020.

[Sato1993-81] Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.

[Kullawong-82] Niwed Kullawong, Sutipa Tanapongpipat, Lily Eurwilaichitr and Witoon Tirasophon (2018). "Unfolded Protein Response (UPR) Induced Hybrid Promoters for Heterologous Gene Expression in Pichia pastoris" (PDF). Chiang Mai Journal of Science. 45 (7): 2554–2565. Retrieved 11 January 2021.

[Rozhdestvensky-83] Timofey S. Rozhdestvensky, Thean Hock Tang, Inna V. Tchirkova, Jürgen Brosius, Jean‐Pierre Bachellerie and Alexander Hüttenhofer (2003). "Binding of L7Ae protein to the K‐turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea". Nucleic Acids Research. 31 (3): 869–77. doi:10.1093/nar/gkg175. Retrieved 2014-06-08.

[Collopy-84] Laura C. Collopy, Tracy L. Ware, Tomas Goncalves, Sunnvør í Kongsstovu, Qian Yang, Hanna Amelina, Corinne Pinder, Ala Alenazi, Vera Moiseeva, Siân R. Pearson, Christine A. Armstrong & Kazunori Tomita (2018). "LARP7 family proteins have conserved function in telomerase assembly" (PDF). Nature Communications. 9 (557): 1–8. doi:10.1038/s41467-017-02296-4. Retrieved 1 August 2019.

[Lindsay-85] William P. Lindsay, Fiona M. McAlister, Qun Zhu, Xian-Zhi He, Wolfgang Dröge-Laser, Susie Hedrick, Peter Doerner, Chris Lamb and Richard A. Dixon (July 2002). "KAP-2, a protein that binds to the H-box in a bean chalcone synthase promoter, is a novel plant transcription factor with sequence identity to the large subunit of human Ku autoantigen". Plant Molecular Biology. 49 (5): 503–514. doi:10.1023/A:1015505316379. Retrieved 5 October 2019.

[Loake-86] Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon (October 1992). "Combination of H-box [CCTACC(N)₇CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate p-coumaricacid" (PDF). Proceedings of the National Academy of Sciences USA. 89 (19): 9230–9234. doi:10.1073/pnas.89.19.9230. Retrieved 16 March 2021.

[Eastmond-87] 87.0 ^87.1 ^87.2 Dawn L. Eastmond and Hillary C. M. Nelson (October 27, 2006). "Genome-wide Analysis Reveals New Roles for the Activation Domains of the Saccharomyces cerevisiae Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response". Journal of Biological Chemistry. 281 (43): P32909–32921. doi:10.1074/jbc.M602454200. Retrieved 19 January 2021.

[Laudet-88] Vincent Laudet, Dominique Stehelin and Hans Clevers (1993). "Ancestry and diversity of the HMG box superfamily" (PDF). Nucleic Acids Research. 21 (10): 2493–501. doi:10.1093/nar/21.10.2493. PMID 8506143. Retrieved 2017-04-05.

[RefSeq6927-89] RefSeq (April 2015). HNF1A HNF1 homeobox A [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 November 2018.

[Li2020-90] 90.0 ^90.1 Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.

[Gardmo-91] Cissi Gardmo and Agneta Mode (1 December 2006). "In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression". Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. PMID 17170084. Retrieved 2017-09-01.

[Kalousova-92] Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik (June 1999). "DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4". Biochemical and Biophysical Research Communications. 259 (3): 510–518. PMID 10364449. Retrieved 6 May 2020.

[Damante-93] G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro (20 June 1994). "Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain" (PDF). Nucleic Acids Research. 22 (15): 3075–83. doi:10.1093/nar/22.15.3075. PMID 7915030. Retrieved 6 May 2020.

[Orlando-94] Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger (19 December 2019). "Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression". Haematologica. 105 (12): 2774–2784. doi:10.3324/haematol.2019.236406. PMID 33256376 Check |pmid= value (help). Retrieved 6 May 2021.

[Higashikawa-95] 95.0 ^95.1 Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi (January 2009). "Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene". Arthritis & Rheumatism. 60 (1): 166–78. doi:10.1002/art.24243. PMID 19116917. Retrieved 2013-06-18.

[Xi-96] Hualin Xi, Yong Yu, Yutao Fu, Jonathan Foley, Anason Halees, and Zhiping Weng (June 2007). "Analysis of overrepresented motifs in human core promoters reveals dual regulatory roles of YY1". Genome Research. 17 (6): 798–806. doi:10.1101/gr.5754707. PMC 1891339. PMID 17567998.

[Kugel-97] Jennifer F. Kugel and James A. Goodrich (2017). "Finding the start site: redefining the human initiator element" (PDF). Genes & Development. 31 (1–2): 1. doi:10.1101/gad.295980.117. Retrieved 9 May 2019.

[Schwank-98] Sabine Schwank, Ronald Ebbert, Karin Rautenstrau𝛃, Eckhart Schweizer and Hans-Joachim Schüller (25 January 1995). "Yeast transcriptional activator IN02 interacts as an Ino2p/Ino4p basic helix-loop-helix heteromeric complex with the inositol/choline responsive element necessary for expression of phospholipid biosynthetic genes in Saccharomyces cerevisiae" (PDF). Nucleic Acids Research. 23 (2): 230–37. doi:10.1093/nar/23.2.230. Retrieved 10 August 2020.

[Case-99] Kendall C. Case, Michael Salsaa, Wenxi Yu and Miriam L. Greenberg (28 December 2018). Gomez-Cambronero J., Frohman M., ed. Regulation of Inositol Biosynthesis: Balancing Health and Pathophysiology, In: Lipid Signaling in Human Diseases. Handbook of Experimental Pharmacology, vol 259. Cham: Springer. pp. 221–260. doi:10.1007/164_2018_181. ISBN 978-3-030-33667-7. Retrieved 29 January 2021.

[Lopes-100] John M. Lopes, Jeanne P. Hirsch, Patricia A. Chorgo, Karen L. Schulze and Susan A. Henry (April 11, 1991). "Analysis of sequences in the INOl promoter that are involved in its regulation by phospholipid precursors" (PDF). Nucleic Acids Research. 19 (7): 1687–1693. doi:10.1093/nar/19.7.1687. PMID 2027776. Retrieved 29 January 2021.

[Lu-101] Mengmeng Lu, Chuanyan Yang, Meijia Li, Qilin Yi, Guangxia Lu, Yichen Wu, Chen Qu, Lingling Wang, and Linsheng Song (May 2018). "A conserved interferon regulation factor 1 (IRF-1) from Pacific oyster Crassostrea gigas functioned as an activator of IFN pathway". Fish & Shellfish Immunology. 76 (May): 68–77. doi:10.1016/j.fsi.2018.02.024. Retrieved 27 March 2021.

[Kulczynska-102] 102.0 ^102.1 Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka (12 February 2020). "A Krüppel-like factor 1 (KLF1) Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity". Molecular and Cellular Biology. 40 (5): e00444–19. doi:10.1128/MCB.00444-19. PMID 31818881. |access-date= requires |url= (help)

[Kim-103] 103.0 ^103.1 ^103.2 Seungsoo Kim, Maitreya J Dunham, Jay Shendure (13 May 2019). "A combination of transcription factors mediates inducible interchromosomal contacts" (PDF). eLife. 8: e42499. doi:10.7554/eLife.42499.001. Retrieved 20 February 2021.

[Boer-104] 104.0 ^104.1 Herman A. de Boer, Lisa J. Comstock, and Mark Vasser (January 1983). "The tac promoter: A functional hybrid derived from the trp and lac promoters" (PDF). Proceedings of the National Academy of Sciences USA. 80 (1): 21–5. Retrieved 2017-02-19.

[Ripoll-105] Vera M. Ripoll, Nicholas A. Meadows, Liza-Jane Raggatt, Ming K. Chang, Allison R. Pettit, Alan I. Cassady and David A. Hume (30 April 2005). "Microphthalmia transcription factor regulates the expression of the novel osteoclast factor GPNMB" (PDF). Gene. 413 (1–2): 32–41. doi:10.1016/j.gene.2008.01.014. Retrieved 18 March 2021.

[Blaiseau-106] Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. |access-date= requires |url= (help)

[Lee2017-107] Sang Yoon Lee & Yoon Kwon Nam (3 July 2017). "Molecular cloning of metal-responsive transcription factor-1 (MTF-1) and transcriptional responses to metal and heat stresses in Pacific abalone, Haliotis discus hannai". Fisheries and Aquatic Sciences. 20: 9. doi:10.1186/s41240-017-0055-y. Retrieved 16 October 2020.

[Branco-108] 108.0 ^108.1 J. Branco, M. Ola, R. M. Silva, E. Fonseca, N. C. Gomes, C. Martins-Cruz, A. P. Silva, A. Silva-Dias, C. Pina-Vaz, C. Erraught, L. Brennan, A. G. Rodrigues, G. Butler and I. M. Miranda (August 2017). "Impact of ERG3 mutations and expression of ergosterol genes controlled by UPC2 and NDT80 in Candida parapsilosis azole resistance". Clinical Microbiology and Infection. 23 (8): 575.e1–575.e8. doi:10.1016/j.cmi.2017.02.002. PMID 28196695. Retrieved 5 September 2020.

[Ozsarac-109] Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.

[Vamvakas-110] Sotirios‐Spyridon Vamvakas, John Kapolos, Lambros Farmakis, Gregoria Koskorellou, Fotios Genneos (14 May 2019). "Ser625 of msn2 transcription factor is indispensable for ethanol tolerance and alcoholic fermentation process". Biotechnology Progress. 35 (5): ee2837. doi:10.1002/btpr.2837. Retrieved 6 February 2021.

[Charlesworth-111] Amanda Charlesworth, Anna Wilczynska, Prajitha Thampi, Linda L Cox, and Angus M MacNicol (21 June 2006). "Musashi regulates the temporal order of mRNA translation during Xenopus oocyte maturation". The EMBO Journal. 25 (12): 2792–2801. doi:10.1038/sj.emboj.7601159. PMID 16763568. Retrieved 17 April 2021.

[Saravanaperuma-112] Siva Arumugam Saravanaperuma, Dario Pediconi, Carlo Renieri, Antonietta La Terza (15 June 2012). "Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant". PLOS ONE. 7 (6): e38657. doi:10.1371/journal.pone.0038657. Retrieved 17 April 2021.

[Kotani-113] Tomoya Kotani, Kaori Maehata, Natsumi Takei (2017). "Regulation of Translationally Repressed mRNAs in Zebrafish and Mouse Oocytes, In: Oocytes. Results and Problems in Cell Differentiation". 63. Cham: Springer: 297–324. doi:10.1007/978-3-319-60855-6_13. Retrieved 17 April 2021.

[Rushton-114] Paul J Rushton and Imre E Somssich (August 1998). "Transcriptional control of plant genes responsive to pathogens" (PDF). Current Opinion in Plant Biology. 1 (4): 311–5. doi:10.1016/1369-5266(88)80052-9. PMID 10066598. Retrieved 5 November 2018.

[pmid17959722-115] 115.0 ^115.1 Potthoff MJ, Olson EN (December 2007). "MEF2: a central regulator of diverse developmental programs". Development. 134 (23): 4131–40. doi:10.1242/dev.008367. PMID 17959722.

[Zia-116] 116.0 ^116.1 ^116.2 Ayisha Zia, Muhammad Imran, and Sajid Rashid (7 February 2020). "In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity". Journal of Chemical Information and Modeling. 60 (3): 1892–1909. doi:10.1021/acs.jcim.0c00008. Retrieved 10 September 2020.

[Oulhen-117] Nathalie Oulhen, S. Zachary Swartz, Jessica Laird, Alexandra Mascaro, Gary M. Wessel (1 February 2017). "Transient translational quiescence in primordial germ cells". Development. 144 (7): 1201. doi:10.1242/dev.144170. Retrieved 6 March 2021.

[Bharathavikru-118] Ruthrothaselvi Bharathavikru, Tatiana Dudnakova, Stuart Aitken, Joan Slight, Mara Artibani, Peter Hohenstein, David Tollervey and Nick Hastie (13 March 2017). "Transcription factor Wilms' tumor 1 regulates developmental RNAs through 3′ UTR interaction". Genes & Development. 31 (4): 347–352. doi:10.1101/gad.291500.116. Retrieved 6 March 2021.

[Huang-119] Kun Huang, Jin Li, Mikako Ito, Jun-Ichi Takeda, Bisei Ohkawara, Tomoo Ogi, Akio Masuda, and Kinji Ohno (8 September 2020). "Gene Expression Profile at the Motor Endplate of the Neuromuscular Junction of Fast-Twitch Muscle". Frontiers in Molecular Neuroscience. 13: 154–165. doi:10.3389/fnmol.2020.00154. PMID 33117128 Check |pmid= value (help). Retrieved 19 March 2021.

[Bai-120] Ge Bai, Da-Hai Yang, Peijian Chao, Heng Yao, MingLiang Fei, Yihan Zhang, Xuejun Chen, Bingguang Xiao, Feng Li, Zhen-Yu Wang, Jun Yang and He Xie (19 December 2020). "Genome-wide identification and expression analysis of NtbHLH gene family in tobacco (Nicotiana tabacum L.) and the role of NtbHLH86 in drought adaptation". Plant Diversity. 10: 4. doi:10.1016/j.pld.2020.10.004. Retrieved 19 March 2021.

[Gao-121] Min Gao, Yanxun Zhu, Jinhua Yang, Hongjing Zhang, Chenxia Cheng, Yucheng Zhang, Ran Wan, Zhangjun Fei & Xiping Wang (18 March 2019). "Identification of the grape basic helix–loop–helix transcription factor family and characterization of expression patterns in response to different stresses". Plant Growth Regulation. 88: 19–39. Retrieved 20 March 2021.

[Fukusumi-122] Takahito Fukusumi, Theresa W. Guo, Shuling Ren, Sunny Haft, Chao Liu, Akihiro Sakai, Mizuo Ando, Yuki Saito, Sayed Sadat, and Joseph A. Califano (February 2021). "Reciprocal activation of HEY1 and NOTCH4 under SOX2 control promotes EMT in head and neck squamous cell carcinoma". International Journal of Oncology. 58 (2): 226–237. doi:10.3892/ijo.2020.5156. PMID 33491747 Check |pmid= value (help). Retrieved 21 March 2021.

[Katz-123] Margaret E Katz and Sarah Cooper (1 December 2015). "Extreme Diversity in the Regulation of Ndt80-Like Transcription Factors in Fungi". G3 Genes. 5 (12): 2783–2792. doi:10.1534/g3.115.021378. Retrieved 8 February 2021. Text "Genomes" ignored (help); Text "Genetics " ignored (help)

[Xu-124] Xu L, Ajimura M, Padmore R, Klein C, Kleckner N (December 1995). "NDT80, a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae". Molecular and Cellular Biology. 15 (12): 6572–81. doi:10.1128/MCB.15.12.6572. PMC 230910. PMID 8524222.

[Lamoureux-125] Lamoureux JS, Stuart D, Tsang R, Wu C, Glover JN (November 2002). "Structure of the sporulation-specific transcription factor Ndt80 bound to DNA". The EMBO Journal. 21 (21): 5721–32. doi:10.1093/emboj/cdf572. PMC 131069. PMID 12411490.

[Hendrickson-126] Hendrickson WA, Ward KB (October 1975). "Atomic models for the polypeptide backbones of myohemerythrin and hemerythrin". Biochemical and Biophysical Research Communications. 66 (4): 1349–56. doi:10.1016/0006-291x(75)90508-2. PMID 5.

[Chu-127] Shelley Chu and Ira Herskowitz (April 1, 1998). "Gametogenesis in Yeast Is Regulated by a Transcriptional Cascade Dependent on Ndt80". Molecular Cell. 1 (5): 685–96. doi:10.1016/S1097-2765(00)80068-4. PMID 9660952.

[Jain-128] Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao (24 February 1995). "A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region" (PDF). Journal of Biological Chemistry. 270 (8): 4138–4145. doi:10.1074/jbc.270.8.4138. PMID 7876165. Retrieved 15 August 2020.

[Blomquist-129] Blomquist P, Belikov S, Wrange O (January 1999). "Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure". Nucleic Acids Research. 27 (2): 517–25. doi:10.1093/nar/27.2.517. PMC 148209. PMID 9862974.

[Boron-130] Walter F. Boron (2003). Medical Physiology: A Cellular And Molecular Approach. Elsevier/Saunders. pp. 125–126. ISBN 1-4160-2328-3.

[Yao2016-131] 131.0 ^131.1 D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor (May 2016). "Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid". Journal of Dairy Science. 99 (5): 3945–3957. doi:10.3168/jds.2015-10601. PMID 26947306. Retrieved 5 September 2020.

[Garaeva-132] Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.

[Kearns-133] Sinéad Kearns, Rudi Lurz, Elena V. Orlova, Andrei L. Okorokov (27 July 2016). "Two p53 tetramers bind one consensus DNA response element". Nucleic Acid Research. 44 (13): 6185–6199. doi:10.1093/nar/gkw215. Retrieved 6 October 2020.

[Yu-134] 134.0 ^134.1 Wangjie Yu and Paul E. Hardin (2006). "Circadian oscillators of Drosophila and mammals". Journal of Cell Science. 119: 4793–5. doi:10.1242/jcs.03174. PMID 17130292. Retrieved 2017-02-19.

[Ghotbi-135] Elnaz Ghotbi, Kristina Lackey, Vicki Wong, Katie T. Thompson, Evan G. Caston, Minna Haddadi, Judith Benes and Richard S. Jones (1 March 2020). "Differential Contributions of DNA-Binding Proteins to Polycomb Response Element Activity at the Drosophila giant Gene" (PDF). Genetics. 214 (3): 623–634. doi:10.1534/genetics.119.302981. PMID 31919108. Retrieved 7 September 2020.

[Ruta-136] Veronica Ruta, Chiara Longo, Andrea Lepri, Veronica De Angelis, Sara Occhigrossi, Paolo Costantino and Paola Vittorioso (8 February 2020). "The DOF Transcription Factors in Seed and Seedling Development". Plants. 9 (2): 218. doi:10.3390/plants9020218. Retrieved 7 January 2021.

[Abiramavalli-137] 137.0 ^137.1 ^137.2 M. Abiramavalli and B. Usha (7 July 2020). "Identification, characterization and expression analysis of sucrose transporters in the model plant Nicotiana tabacum cv.petit havana" (PDF). Journal of Environmental Biology. 41: 803–811. doi:10.22438/jeb/41/4/MRN-1233. Retrieved 7 January 2021.

[Yao-138] 138.0 ^138.1 Yao EF, Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.

[Pietenpol-139] Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses (November 15, 1991). "Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor β1 and by the retinoblastoma gene product" (PDF). Proceedings of the National Academy of Sciences USA. 88 (22): 10227–10231. doi:10.1073/pnas.88.22.10227. PMID 1946442. Retrieved 5 December 2018.

[Sato-140] 140.0 ^140.1 ^140.2 ^140.3 ^140.4 Hiroshi Sato, Megumi Kita, and Motoharu Seiki (5 November 1993). "v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements" (PDF). The Journal of Biological Chemistry. 268 (31): 23460–8. PMID 8226872. Retrieved 13 August 2020.

[Kumar-141] Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq (9 August 2016). "A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome". Frontiers in Human Neuroscience. 10: 403. doi:10.3389/fnhum.2016.00403. PMID 27555815. Retrieved 7 September 2020.

[Gu-142] 142.0 ^142.1 ^142.2 Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.

[Wang2016-143] Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen (May 2016). "ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer". Nature Medicine. 22 (5): 488–496. doi:10.1038/nm.4070. PMID 27019329. Retrieved 6 September 2020.

[Hartmann-144] Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar (January 2005). "Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes" (PDF). Plant Molecular Biology. 57 (2): 155–171. doi:10.1007/s11103-004-6910-0. PMID 15821875. Retrieved 10 November 2018.

[Misra-145] 145.0 ^145.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.

[Cogswell-146] John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting (October 1990). "X-box-binding proteins positively and negatively regulate transcription of the HLA-DRA gene through interaction with discrete upstream W and V elements" (PDF). Proceedings of the National Academy of Sciences USA. 87 (19): 7703–7707. doi:10.1073/pnas.87.19.7703. PMID 2120707. Retrieved 20 August 2020.

[Ghislain-147] 147.0 ^147.1 Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish (June 2001). "The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds In Vitro to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes" (PDF). Journal of Interferon and Cytokine Research. 21 (6): 379–388. doi:10.1089/107999001750277. PMID 11440635. Retrieved 15 August 2020.

[Wesoly-148] Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen (31 March 2007). "STAT activation and differential complex formation dictate selectivity of interferon responses". Acta Biochimica Polonica. 54 (1): 27–38. doi:10.18388/abp.2007_3266. PMID 17351669. Retrieved 15 August 2020.

[Tornos-149] Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto (31 January 2013). "Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF". PLoS ONE. 8 (1): e53848. doi:10.1371/journal.pone.0053848. PMID 23382855. Retrieved 12 November 2018.

[Rivero-150] Francisco Rivero (June 2002). "mRNA processing in Dictyostelium: sequence requirements for termination and splicing" (PDF). Protist. 153 (2): 169–76. doi:10.1078/1434-4610-00095. PMID 12125758. Retrieved 2017-04-05.

[Fonseca-151] Rodrigo Nunes da Fonseca and Thiago M. Venancio (1 March 2018). "Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda". Plos Genetics. 14 (3): e1007201. doi:10.1371/journal.pgen.1007201. PMID 29494591. Retrieved 5 September 2020.

[Conlon-152] Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith (2001). "Determinants of T box protein specificity" (PDF). Development. 128 (19): 3749–3758. PMID 11585801. Retrieved 17 November 2018.

[Liu-153] Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko (25 October 2016). "Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites". Proceedings of the National Academy of Sciences of the USA. 113 (43): E6572–E6581. doi:10.1073/pnas.1613914113. PMID 27791029. Retrieved 28 August 2020.

[Schweizer-154] 154.0 ^154.1 Anja Schweizer, Steffen Rupp, Brad N. Taylor, Martin Röllinghoff, Klaus Schröppel (November 2000). "The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in Candida albicans". Molecular Microbiology. 38 (3): 435–445. doi:10.1046/j.1365-2958.2000.02132.x. Retrieved 21 April 2021.

[Maru-155] Yoshiro Maru (2016). Basic Research, In: "Inflammation and Metastasis". Tokyo: Springer. pp. 193–231. doi:10.1007/978-4-431-56024-1_10. ISBN 978-4-431-56022-7. Retrieved 28 August 2020.

[Pinto-156] Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford (1 September 2017). "Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation". Endocrinology. 158 (9): 3067–3078. doi:10.1210/en.2017-00314. PMID 28911178. Retrieved 5 September 2020.

[pmid2308859-157] Henthorn P, McCarrick-Walmsley R, Kadesch T (February 1990). "Sequence of the cDNA encoding ITF-1, a positive-acting transcription factor". Nucleic Acids Research. 18 (3): 677. doi:10.1093/nar/18.3.677. PMID 2308859.

[pmid1967983-158] Kamps MP, Murre C, Sun XH, Baltimore D (February 1990). "A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL". Cell. 60 (4): 547–55. doi:10.1016/0092-8674(90)90658-2. PMID 1967983.

[159] E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment

[Piskacek-160] Piskacek S (2007). "Nine-amino-acid transactivation domain: Establishment and prediction utilities". Genomics. 89 (6): 756–768. doi:10.1016/j.ygeno.2007.02.003. PMID 17467953.

[161] Piskacek, Martin; Vasku, A; Hajek, R; Knight, A (2015). "Shared structural features of the 9aaTAD family in complex with CBP". Mol. Biosyst. 11 (3): 844–851. doi:10.1039/c4mb00672k. PMID 25564305.

[RefSeq6929-162] RefSeq (September 2011). "TCF3 transcription factor 3 [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 November 2020.

[Yamamoto-163] 163.0 ^163.1 Tomomi M. Yamamoto, Jonathan M. Cook, Cassandra V. Kotter, Terry Khat, Kevin D. Silva, Michael Ferreyros, Justin W. Holt, Jefferson D. Knight, and Amanda Charlesworth (October 2013). "Zar1 represses translation in Xenopus oocytes and binds to the TCS in maternal mRNAs with different characteristics than Zar2". Biochim Biophys Acta. 1829 (10): 1034–46. doi:10.1016/j.bbagrm.2013.06.001. PMID 23827238. Retrieved 19 April 2021.

[Read-164] 164.0 ^164.1 ^164.2 ^164.3 Martin L. Read, Andrew R. Clark and Kevin Docherty (1993). "The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer" (PDF). Biochemical Journal. 295: 233–237. doi:10.1042/bj2950233. PMID 8216223. Retrieved 14 August 2020.

[Kakhki-165] Majid Pahlevan Kakhki, Abbas Nikravesh, Zeinab Shirvani Farsani, Mohammad Ali Sahraian, Mehrdad Behmanesh (April 2018). "HOTAIR but not ANRIL long non‐coding RNA contributes to the pathogenesis of multiple sclerosis". Immunology. 153 (4): 479–487. doi:10.1111/imm.12850. Retrieved 8 March 2021.

[Eulgem-166] Thomas Eulgem and Imre E Somssich (2007). "Networks of WRKY transcription factors in defense signaling" (PDF). Current Opinion in Plant Biology. 10: 366–371. doi:10.1016/j.pbi.2007.04.020. Retrieved 17 October 2018.

[pmid8541496-167] Rushton, Paul; Macdonald, H.; Huttly, A.K.; Lazarus, C.M.; Hooley, R (1995). "Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes". Plant Molecular Biology. 29: 691–702. doi:10.1007/bf00041160. PMID 8541496.

[pmid20304701-168] Rushton PJ, Somssich IE, Ringler P, Shen QJ (May 2010). "WRKY transcription factors". Trends Plant Science. 15 (5): 247–58. doi:10.1016/j.tplants.2010.02.006. PMID 20304701.

[Tokusumi-169] Yumiko Tokusumi, Ying Ma, Xianzhou Song, Raymond H. Jacobson, and Shinako Takada (March 2007). "The New Core Promoter Element XCPE1 (X Core Promoter Element 1) Directs Activator-, Mediator-, and TATA-Binding Protein-Dependent but TFIID-Independent RNA Polymerase II Transcription from TATA-Less Promoters". Molecular and Cellular Biology. 27 (5): 1844–58. doi:10.1128/MCB.01363-06. PMID 17210644. Retrieved 2013-02-09.

[Shen-170] Shen ES, Whitlock JP (April 1992). "Protein-DNA interactions at a dioxin-responsive enhancer. Mutational analysis of the DNA-binding site for the liganded Ah receptor". The Journal of Biological Chemistry. 267 (10): 6815–9. PMID 1313023.

[Lusska-171] Lusska A, Shen E, Whitlock JP (March 1993). "Protein-DNA interactions at a dioxin-responsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded Ah receptor". The Journal of Biological Chemistry. 268 (9): 6575–80. PMID 8384216.

[Wharton-172] Wharton KA, Franks RG, Kasai Y, Crews ST (December 1994). "Control of CNS midline transcription by asymmetric E-box-like elements: similarity to xenobiotic responsive regulation". Development. 120 (12): 3563–9. PMID 7821222.

[Bacsi-173] Bacsi SG, Reisz-Porszasz S, Hankinson O (March 1995). "Orientation of the heterodimeric aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence". Molecular Pharmacology. 47 (3): 432–8. PMID 7700240.

[Swanson-174] Swanson HI, Chan WK, Bradfield CA (November 1995). "DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins". The Journal of Biological Chemistry. 270 (44): 26292–302. doi:10.1074/jbc.270.44.26292. PMID 7592839.

[Boutros-175] Boutros PC, Moffat ID, Franc MA, Tijet N, Tuomisto J, Pohjanvirta R, Okey AB (August 2004). "Dioxin-responsive AHRE-II gene battery: identification by phylogenetic footprinting". Biochemical and Biophysical Research Communications. 321 (3): 707–15. doi:10.1016/j.bbrc.2004.06.177. PMID 15358164.

[Sogawa-176] Sogawa K, Numayama-Tsuruta K, Takahashi T, Matsushita N, Miura C, Nikawa J, Gotoh O, Kikuchi Y, Fujii-Kuriyama Y (June 2004). "A novel induction mechanism of the rat CYP1A2 gene mediated by Ah receptor-Arnt heterodimer". Biochemical and Biophysical Research Communications. 318 (3): 746–55. doi:10.1016/j.bbrc.2004.04.090. PMID 15144902.

[Fernandes-177] Lisete Fernandes, Claudina Rodrigues-Pousada, Kevin Struhl (December 1997). "Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions". Molecular and Cellular Biology. 17 (12): 6982–6993. doi:10.1128/MCB.17.12.6982. Retrieved 11 March 2021.

[Mejlvang-178] Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky (November 2007). "Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition". Molecular Biology of the Cell. 18 (11): 4615–4624. doi:10.1091/mbc.e07-05-0406. PMID 17855508. Retrieved 15 November 2018.

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78]

[79]

[80]

[81]

[82]

[83]

[84]

[85]

[86]

[87]

[88]

[89]

[90]

[91]

[92]

[93]

[94]

[95]

[96]

[97]

[98]

[99]

[100]

v t e Gene project
Articles	Complex locus A1BG and ZNF497 Grainyhead-like Genes in Regulating Development and Genetic Defects Lysenin Lysine: biosynthesis, catabolism and roles RIG-I like receptors ShK toxin: history, structure and therapeutic applications for autoimmune diseases
Categories	Biochemistry Biology Genetics Medicine
Laboratories	AGC box gene transcription laboratory ATA box gene transcription laboratory C and D boxes gene transcription laboratory CArG box gene transcription laboratory CGCG box gene transcription laboratory CRE box gene transcription laboratory E2 box gene transcription laboratory Enhancer box gene transcription laboratory Factor II B recognition element gene transcription laboratory GA responsive complex gene transcription laboratory GC box gene transcription laboratory H box gene transcription laboratory HNF6 gene transcription laboratory HY box gene transcription laboratory Initiator element gene transcription laboratory Metal responsive element gene transcription laboratory STAT5 gene transcription laboratory TATA box gene transcription laboratory
Lessons	A1BG gene transcription programming Amino Acids Enzymes Enzyme catalysis Enzyme structure and function Eukaryotic transcription Gene regulation in prokaryotes
Lists	Biomolecules
Modules	Module:Infobox gene Module:InfoboxImage
Original research	Gene project
Projects	Biochemistry Gene project History of biology Molecular Biology Molecular evolution Topobiology
Proposals	Gene expressions/Cost sharing and research products Gene expressions in human exploration beyond low earth orbits Gene expressions/Project narrative
Resources	5' cap Acid-base homeostasis Actins Adenines Allergies Alpha-1-B glycoprotein Ammonoids Original research/Amino acids Amphiphiles Anabolism Animal physiology Anomeric carbons Autocatalytic reactions Autonomously replicating sequences Base pairs Biology Biodegradation Biosynthesis Biosynthesis of a human protein Biosynthesis of amino acids Blood Bodily fluids Botany Brain box Calcium signaling Capping enzymes Carbohydrates Carcinoembryonic antigen gene family Catabolism Catalysis Cells Cell signaling Centrosomes Chromatins Chromoboxes Coactivators Corepressors Cofactors Consensus sequences Cytogenetics Cytokinesis Cytosines Deoxyribonucleic acids Digestion Disaccharides Dispersed promoters Dominant group metagenomes Downregulations Endochondral ossification Enzyme inhibitors Enzymology Epigenetics Epigenomes Esters Esterification Eukaryotes Eukaryotic initiation factors Evolution Exaptation Excision repair cross-complementing Factors Fatty acids Ferredoxin Foldings Foods Forkhead boxes Functional groups Genome surveillance complexes Genealogy Genes Genetics Gene transcriptions Genomes Genomics Glycoproteins Glycosides Glycosidic bond Guanines Hair color gene expressions Helicases Heredity History of agriculture Greek and Roman histories of biology Homeostasis Human amino acid synthesis Human DNAs Human genes Human RNA Human teeth Human temperatures Immunoglobulin domain cl11960 Immunoglobulin domain genes Immunoglobulin like domain cd05751 Immunoglobulin like domain pfam13895 Immunoglobulin like domain smart00410 Immunoglobulin receptor superfamily genes Immunoglobulin supergene family Inhibitory peptides Insulators Intranuclear localizations Introduction to Cell Biology Introduction to polymer chemistry Lamarckism Leucine zipper Localization Major histocompatibility complex class I gene family Major histocompatibility complex class II gene family Major histocompatibility complex class III gene family Mammalogy Mathematical molecular biology Mediator complexes Medicine Melanocytes Membranes Metagenomes Molecular biology Molecular genetics Nitrogen metabolism Nucleotide Synthesis Origin of life Orthomolecular medicine Osteoarthritis Paleanthropology Paleontology Phosphate biochemistry Phosphate budgets Phosphate reactions Post translational modifications Principles of biosynthesis Protein isoform Proteins Proteomics Regulations Ribonucleotides Ribosomes RNA polymerases RNA polymerase II holoenzymes RNA polymerase II holoenzyme complexes RNA translations Salinity Stroke management Teeth TFIIA Transports Vascular endothelial growth factor A What is a human? Upregulations Upstream and downstream ZSCAN22 Zoology
Transcription resources	A1BG gene transcription core promoters A1BG gene transcriptions A1BG regulatory elements and regions A1BG response element gene transcriptions A1BG response element negative results A1BG response element positive results ABA-response element gene transcriptions Abf1 regulatory factor gene transcriptions A box gene transcriptions ACGT-containing element gene transcriptions Activating protein gene transcriptions Activating transcription factor gene transcriptions Adenylate–uridylate rich element gene transcriptions Adr1p gene transcriptions Aft1p gene transcriptions AGC box gene transcriptions AGCE gene transcriptions Alpha-amylase conserved element gene transcriptions Amino acid response element gene transcriptions AARE-like Androgen response element gene transcriptions Angiotensinogen core promoter element gene transcriptions Antioxidant-electrophile responsive element gene transcriptions ATA box gene transcriptions Auxin response factor gene transcriptions B box gene transcriptions Bioinformatics tool gene transcriptions Box gene transcriptions Bridge gene transcriptions CAAT box gene transcriptions CadC binding domain gene transcriptions Calcineurin-responsive transcription factor gene transcriptions Calcium-response element gene transcriptions cAMP response element gene transcriptions C and D boxes gene transcriptions Carbohydrate response element gene transcriptions Carbon source-responsive element gene transcriptions Carcinoembryonic antigen gene family CARE gene transcriptions CArG box gene transcriptions CAT box gene transcriptions Cat8p gene transcriptions Cbf1 regulatory factor gene transcriptions C box gene transcriptions CCCTC-binding factor gene transcriptions C-EBP box gene transcriptions Cell-cycle box gene transcriptions Cell cycle regulation gene transcriptions CENP-B box gene transcriptions CGCG box gene transcriptions Circadian control element gene transcriptions Cold-responsive element gene transcriptions Complement copy gene transcriptions Complement-inverse copy gene transcriptions Consensus sequence gene transcriptions Copper response element gene transcriptions Core promoter gene transcriptions Coupling element gene transcriptions CRE box gene transcriptions Cytokinin response regulator gene transcriptions Cytoplasmic polyadenylation element gene transcriptions DAF-16-associated element gene transcriptions DAF-16 binding element gene transcriptions D box gene transcriptions Defense and stress-responsive element gene transcriptions Degenerate nucleotide gene transcriptions Dispersed promoter gene transcriptions Distal promoter gene transcriptions DNA melting gene transcriptions DNA damage response element gene transcriptions DNA replication-related element gene transcriptions Downstream core element gene transcriptions Downstream promoter element gene transcriptions Downstream TFIIB recognition element gene transcriptions DREB box gene transcriptions E2 box gene transcriptions EIF4E basal element gene transcriptions EIN3 binding site gene transcriptions Enhancer activity copy gene transcriptions E box gene transcriptions Element gene transcriptions Endoplasmic reticulum stress response element gene transcriptions Endosperm expression gene transcriptions Enhancer box gene transcriptions Estrogen response element gene transcriptions Ethylene responsive element gene transcriptions Factor II B recognition element gene transcriptions F box gene transcriptions Focused promoter gene transcriptions Forkhead box gene transcriptions Fur box gene transcriptions GAAC element gene transcriptions Gal4p gene transcriptions Γ-interferon activated sequence gene transcriptions GARE gene transcriptions GA responsive complex gene transcriptions GATA gene transcriptions G box gene transcriptions GC box gene transcriptions GCC box gene transcriptions Gcn4p gene transcriptions Gcr1p gene transcriptions Gene expressions General factor II D gene transcriptions General regulatory factors General transcription factor II A gene transcriptions General transcription factor II B gene transcriptions General transcription factor II D gene transcriptions General transcription factor II F gene transcriptions General transcription factor II H gene transcriptions General transcription factor gene transcriptions Gene transcriptions GGC triplet gene transcriptions Gibberellin responsive element gene transcriptions GLM box gene transcriptions Glucocorticoid response element gene transcriptions Grainy head gene transcriptions Grainy head transcription factor gene transcriptions Growth hormone response element gene transcriptions GT boxes Hac1p gene transcriptions Hair color gene expressions H and ACA box gene transcriptions H box gene transcriptions Heat-responsive element gene transcriptions Hex sequence gene transcriptions HMG box gene transcriptions HNF gene transcriptions Homeobox gene transcriptions Hsf1p gene transcriptions HY box gene transcriptions Hybrid C, A boxes Hybrid C, G boxes Hybrid C, T boxes Hypoxia-inducible factor gene transcriptions Hypoxia response elements I box gene transcriptions Initiator element gene transcriptions Initiator-like element gene transcriptions Inositol/choline-responsive elements Interaction gene transcriptions Interferon regulatory factors Inverse copy gene transcriptions Jasmonic acid-responsive element gene transcriptions K-boxes Kozak sequence gene transcriptions Kruppel-associated box gene transcriptions Krüppel-like factor gene transcriptions L box gene transcriptions Leu3 gene transcriptions M35 box gene transcriptions MADS box gene transcriptions Maf recognition element gene transcriptions M box gene transcriptions Mcm1 regulatory factor gene transcriptions Met31p box gene transcriptions Metal responsive element gene transcriptions Middle sporulation element gene transcriptions Mig1p gene transcriptions Model samplings Motif ten element gene transcriptions Msn2,4p gene transcriptions Musashi binding element gene transcriptions MYB recognition element gene transcriptions Myelocytomatosis transcription factor gene transcriptions Myocyte enhancer factor gene transcriptions N-boxes Ndt80p gene transcriptions Nuclear factor 1 Nuclear factor 𝜿B Nuclear factor gene transcriptions Nuclear factor of activated T cell gene transcriptions (NFAT) Nuclear factor Y gene transcriptions Nutrient-sensing response element gene transcriptions Oaf1p gene transcriptions ORE1 binding site gene transcriptions p53 response element gene transcriptions P63 DNA-binding site gene transcriptions P box gene transcriptions Pdr1,3p gene transcriptions Peroxisome proliferator hormone response element gene transcriptions Phosphate starvation-response transcription factor gene transcriptions Pollen1 element gene transcriptions Polycomb response element gene transcriptions Preinitiation complex Preinitiation complex gene transcriptions Pribnow box gene transcriptions Prolamin box gene transcriptions Promoter gene transcriptions Proximal promoter gene transcriptions Promoter occurrence gene transcriptions Pyrimidine box gene transcriptions Q element gene transcriptions Rap1 regulatory factor gene transcriptions Reb1 general regulatory factor gene transcriptions Retinoblastoma control element gene transcriptions Retinoic acid response element gene transcriptions Rgt1p gene transcriptions Rlm1p gene transcriptions RNA polymerase II gene transcriptions RNA polymerase II holoenzyme complex Root specific element gene transcriptions ROR-response element gene transcriptions Rox1p gene transcriptions Rpn4p gene transcriptions R response element gene transcriptions SARE gene transcriptions Seed-specific element gene transcriptions Serum response element gene transcriptions Servenius sequence gene transcriptions Shoot specific element gene transcriptions Sip4p gene transcriptions Smp1p gene transcriptions Sp1 gene transcriptions Spaceflight gene expressions Specificity protein gene transcriptions STAT gene transcriptions Ste12p gene transcriptions Sterol response element gene transcriptions Sucrose box gene transcriptions Synaptic Activity-Responsive Elements TACTAAC box gene transcriptions TAGteam gene transcriptions Tapetum box gene transcriptions TATA binding protein associated factor gene transcriptions TATA binding protein gene transcriptions TATA box gene transcriptions TAT box gene transcriptions TATC box gene transcriptions Tbf1 regulatory factor gene transcriptions T box gene transcriptions TCCACCATA element gene transcriptions TC element gene transcriptions TCT gene transcriptions TEA consensus sequence gene transcriptions Tec1p gene transcriptions Telomeric repeat DNA-binding factor gene transcriptions Tetradecanoylphorbol-13-acetate response element gene transcriptions TGF-β control elements (TCEs) TGF-β inhibitory elements (TIEs) Thyroid hormone response element gene transcriptions Transcriptional regulation Transcription bubble gene transcriptions Transcription factor gene transcriptions Transcription factor 3 gene transcriptions Transcription factory gene transcriptions Transcription start site gene transcriptions Translational control sequence gene transcriptions U box gene transcriptions Unfolded protein response element gene transcriptions Upstream response element gene transcriptions Upstream stimulatory factor gene transcriptions UTR promoter gene transcriptions V and P box gene transcriptions V box gene transcriptions Vhr1p gene transcriptions Vitamin D response element gene transcriptions W box gene transcriptions X box gene transcriptions Xbp1p gene transcriptions X core promoter element gene transcriptions Xenobiotic response element gene transcriptions Xenobiotic responsive element gene transcriptions Yap1p,2p gene transcriptions Y box gene transcriptions YY1 gene transcriptions Zap1p gene transcriptions Z box gene transcriptions Zinc responsive element gene transcriptions

@@ Line 144: / Line 144: @@
 |pmid=22966202
 |accessdate=8 August 2020 }}</ref> "CUX2, a highly female-specific liver transcription factor, contributes to an analogous regulatory network in female liver. Adenoviral overexpression of CUX2 in male liver induced 36% of female-biased genes and repressed 35% of male-biased genes. In female liver, CUX2 small interfering RNA (siRNA) preferentially induced genes repressed by adenovirus expressing CUX2 (adeno-CUX2) in male liver, and it preferentially repressed genes induced by adeno-CUX2 in male liver. CUX2 binding in female liver chromatin was enriched at sites of male-biased DNase hypersensitivity and at genomic regions showing male-enriched STAT5 binding. CUX2 binding was also enriched near genes repressed by adeno-CUX2 in male liver or induced by CUX2 siRNA in female liver but not at genes induced by adeno-CUX2, indicating that CUX2 binding is preferentially associated with gene repression. Nevertheless, direct CUX2 binding was seen at several highly female-specific genes that were positively regulated by CUX2, including A1bg [A1BG in humans], Cyp2b9, Cyp3a44, Tox [TOX in humans], and Trim24 [TRIM24 in humans]."<ref name=Conforto/>
+"Gene list comparisons were performed using the compare class utility provided by the Regulatory Sequence Analysis Tools (34). Comparisons were made with previous 3-AT and rapamycin data sets (5, 14) and with several predefined gene lists such as genes induced by promoters bound in chromatin immunoprecipitation (ChIP-chip) experiments (35), genes in the MIPS functional catalogue (36), and gene ontology categories (37) as described by Godard et al. (38). The significance of overlap between gene lists was quantitatively determined by the hypergeometric distribution (39), using the number of probe sets on the S98 array as the population size, or by calculating the representation factor (40) using the web utility Microarray Analysis Tools. Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters. The program oligo-analysis (41) was used to search the promoter regions of co-regulated genes for overrepresented sequence motifs. Analysis of the 5􏰈-noncoding regions of the GCN4-dependent activation core identified the consensus [general control responsive element] GCRE motif (TGABTVW)."<ref name=Staschke>{{ cite journal
+|author=Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek
+|title=Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen
+Assimilation in Yeast
+|journal=The Journal of Biological Chemistry
+|date=May 28, 2010
+|volume=285
+|issue=22
+|pages=16893–16911
+|url=https://www.jbc.org/content/285/22/16893.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.M110.121947
+|pmid=
+|accessdate=4 January 2021 }}</ref>
 ==ABA-response elements==
 {{main|ABA-response element gene transcriptions}}
-"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."<ref name=Watanabe/>
+"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."<ref name=Watanabe>{{ cite journal
+|author=Kenneth A. Watanabe
+|author2=Arielle Homayouni
+|author3=Lingkun Gu
+|author4=Kuan‐Ying Huang
+|author5=Tuan‐Hua David Ho
+|author6=Qingxi J. Shen
+|title=Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element
+|journal=Plant, Cell & Environment
+|date=18 June 2017
+|volume=40
+|issue=9
+|pages=2004-2016
+|url=https://onlinelibrary.wiley.com/doi/full/10.1111/pce.13006
+|arxiv=
+|bibcode=
+|doi=10.1111/pce.13006
+|pmid=
+|accessdate=5 October 2020 }}</ref>
 "Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."<ref name=Watanabe/>
-===ABRE core promoters===
-{{main|Core promoter gene transcriptions}}
-Positive strand, positive direction: 5'-ACGTGGC-3' at 4344 and complement.
-===ABRE proximal promoters===
-{{main|Proximal promoter gene transcriptions}}
-Positive strand, negative direction: 5'-ACGTGGC-3' at 4239 and complement.
-===ABRE distal promoters===
-{{main|Distal promoter gene transcriptions}}
-Negative strand, negative direction: 5'-CTGTGCA-3' at 3429 and complement.
-Positive strand, positive direction: 5'-GACACGT-3' at 2960, 5'-ACGTGTC-3' at 1823 and complements.
 ==Abf1 regulatory factors==
-{{main|Abf1 regulatory factors}}
+{{main|Abf1 regulatory factor gene transcriptions}}
+Specific "sequences considered as exact Abf1 motif occurrences": CGTNNNNNACGA(C/T), CGTNNNNNA(C/T)GAC, CGTNNNNNA(C/T)GA(C/T), CGTNNNNN(A/G)(C/T)GA(C/T).<ref name=Rossi/>
-===Abfm regulatory factor distal promoters===
-{{main|Distal promoter gene transcriptions}}
-Positive strand, negative direction: 5'-CGTTCTTTATGAT-3' at 352 and complement.
-Positive strand, positive direction: 5'-CGTCACCGGTGAC-3' at 2073, 5'-CGTTCGGTGTGAC-3' at 346 and complements.
 ==A boxes==
@@ Line 212: / Line 227: @@
 |pmid=26018137
 |accessdate=14 August 2020 }}</ref>
-===A box proximal promoters===
-{{main|Proximal promoter gene transcriptions}}
-Negative direction: 5'-TACGTA-3' at 4246 and complement.
-===A box distal promoters===
-{{main|Distal promoter gene transcriptions}}
-Positive direction: 5'-TACGTA-3' at 3071 and complement.
-===Box A distal promoters===
-Negative direction: 5'-TGACTCT-3' at 2788 and complement.
-Positive direction: 5'-TCTCAGT-3' at 2613 and complement.
 ==Abscisic acid-responsive elements==
 {{main|Phosphate starvation-response transcription factor gene transcriptions}}
-Abscisic acid-responsive elements (CACGTG).<ref name=Sharma/>
+Abscisic acid-responsive elements (CACGTG).<ref name=Sharma>{{ cite journal
+|author=Bhaskar Sharma
+|author2=Joemar Taganna
+|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
+|journal=Scientific Reports
+|date=12 June 2020
+|volume=10
+|issue=9581
+|pages=
+|url=https://www.nature.com/articles/s41598-020-66553-1
+|arxiv=
+|bibcode=
+|doi=10.1038/s41598-020-66553-1
+|pmid=32533036
+|accessdate=27 August 2020 }}</ref>
 "The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi/>
@@ Line 247: / Line 262: @@
 The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of ''HIS4'' and ''PHO5'' regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].<ref name=Tang/>
-===Phop core promoters===
-{{main|Core promoter gene transcriptions}}
-Positive strand, negative direction: 5'-CACATT-3' at 4533 and complement.
-===Pho4 distal promoters===
-{{main|Distal promoter gene transcriptions}}
-Negative strand, positive direction: 5'-CACGTG-3' at 570 and complement.
-Positive strand, positive direction: 5'-CACGTG-3' at 3884, 5'-CACGTG-3' at 2961, 5'-CACGTG-3' at 1219, and 5'-CACGTG-3' at 547 and complements.
-===Phop distal promoters===
-{{main|Distal promoter gene transcriptions}}
-Negative strand, negative direction: 5'-TTACAC-3' at 4091, 5'-AACGTG-3' at 3288, 3'-CACGTT-5' at 2864, 3'-CACATT-5' at 2087, 5'-TTACAC-3' at 2064, 5'-AACGTG-3' at 1718, 3'-CACGTT-5' at 1536, 5'-AACGTG-3' at 1346, 5'-AACGTG-3' at 1338, 3'-CACATG-5' at 797, 3'-CACATT-5' at 612, and 3'-CACATG-5' at 324 and complements.
-Positive strand, negative direction: 5'-CACATG-3' at 2667, 5'-CACGTT-3' at 343 and complements.
-Negative strand, positive direction: 5'-CATGTG-3' at 3958, 5'-CACATG-3' at 3956, 5'-CATGTG-3' at 3902, 5'-CACATG-3' at 3742, 5'-CACATG-3' at 3707, 5'-CACATG-3' at 2031, 5'-CACGTG-3' at 570, 5'-AATGTG-3' at 229 and complements.
-Positive strand, positive direction: 5'-CACGTG-3' at 3884, 5'-CACGTG-3' at 2961, 5'-CACGTT-3' at 2801, 5'-CACGTT-3' at 2335, 5'-CACGTG-3' at 1219, 5'-CACGTG-3' at 547 and complements.
 ==ACA boxes==
@@ Line 284: / Line 279: @@
 |pmid=9858580
 |accessdate=5 November 2018 }}</ref>
-===H and ACA box core promoters===
-Positive strand, negative direction: 5'-AGGACA-3' at 4468 and complements.
-===H and ACA box proximal promoters===
-Negative strand, positive direction: 3'-AGGACA-3' at 4252 and complements.
-===H and ACA box distal promoters===
-Negative strand, negative direction: 5'-AGGACA-3' at 1911 and complements.
-Negative strand, positive direction: 5'-ACAGGA-3' at 3572, 3'-AGGACA-3' at 3131, 3'-AGGACA-3' at 2460 and complements.
-Positive strand, negative direction: 5'-AGGACA-3' at 3756, 5'-AGGACA-3' at 3389, 5'-ACAGGA-3' at 2690 and complements.
-Positive strand, positive direction: 5'-AGGACA-3' at 3622, 5'-ACAGGA-3' at 3620, 5'-AGGACA-3' at 144 and complements.
 ==ACGT-containing elements==
 {{main|ACGT-containing element gene transcriptions}}
-{{main|MYB recognition element gene transcriptions}}
+The "binding affinities of both bZIP proteins were similar to CRE<sup>A/T</sup> (ATGACGTCAT), a CRE sequence with flanking adenine and thymine (A/T) at positions -4 and +4. [The] bZIP domains of both STF1 and HY5 have similar binding properties for recognizing ACGT-containing elements (ACEs). [Although] the G-box is a known target site for the HY5 protein, the C-box sequences are the preferred binding sites for both STF1 and HY5."<ref name=Song/>
-===A box proximal promoters===
+==Activating protein 2==
+{{main|Activating protein gene transcriptions}}
+"AP-2 proteins can bind to G/C-rich elements, such as 5’-[G/C]CCN(3,4)GG[G/C]-3’ (41, 42)."<ref name=Murata>{{ cite journal
+|author=Takayuki Murata, Chieko Noda, Yohei Narita1, Takahiro Watanabe, Masahiro Yoshida, Keiji Ashio, Yoshitaka Sato, Fumi Goshima, Teru Kanda, Hironori Yoshiyama, Tatsuya Tsurumi, and Hiroshi Kimura
+|title=Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)
+|journal=Journal of Virology
+|date=27 January 2016
+|volume=
+|issue=
+|pages=
+|url=https://jvi.asm.org/content/jvi/early/2016/01/21/JVI.03227-15.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1128/JVI.03227-15
+|pmid=
+|accessdate=4 October 2020 }}</ref>
-Negative direction: 5'-TACGTA-3' at 4246 and complement.
+Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC.<ref name=Cohen>{{ cite journal
+|author=Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo
+|title=Structural characterization of the complete human perlecan gene and its promoter
+|journal=Proceedings of the National Academy of Sciences USA
+|date=1 November 1993
+|volume=90
+|issue=21
+|pages=10404-10408
+|url=https://www.pnas.org/content/pnas/90/21/10404.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.90.21.10404
+|pmid=8234307
+|accessdate=6 September 2020 }}</ref>
-===A box distal promoters===
+==Activating transcription factors==
+{{main|Activating transcription factor gene transcriptions}}
+"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."<ref name=Burton>{{ cite journal
+|author=Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud
+|title=The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4
+|journal=Journal of Biological Chemistry
+|date=22 May 2020
+|volume=295
+|issue=21
+|pages=7418
+|url=https://www.jbc.org/content/early/2020/04/20/jbc.RA119.011864.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.RA119.011864
+|pmid=32312748
+|accessdate=5 September 2020 }}</ref>
-Positive direction: 5'-TACGTA-3' at 3071 and complement.
+==Adenylate–uridylate rich elements==
+{{main|Adenylate–uridylate rich element gene transcriptions}}
+"The 3′UTRs were searched for the 13-bp pattern WWWUAUUUAUWW with mismatch=−1 which was computationally derived as previously described ( 2 ). The pattern was further statistically validated against larger sets of mRNA data (10 872 mRNA with 3′UTR; GenBank 119) showing occurrence of the motif in 6.8% of human mRNA."<ref name=Bakheet>{{ cite journal
+|author=Tala Bakheet, Bryan R. G. Williams, and Khalid S. A. Khabar
+|title=ARED 2.0: an update of AU-rich element mRNA database
+|journal=Nucleic Acids Research
+|date=1 January 2003
+|volume=31
+|issue=1
+|pages=421-423
+|url=https://academic.oup.com/nar/article/31/1/421/2401201?login=true
+|arxiv=
+|bibcode=
+|doi=10.1093/nar/gkg023
+|pmid=
+|accessdate=23 March 2021 }}</ref>
-===ABRE core promoters===
+"3′ untranslated regions play an important role in regulating mRNA fate by complexing with RNA binding proteins that help control mRNA localization, translation, and stability [1, 2, 3]. Identification of a consensus UUAUUUAU sequence in the 3′ UTRs of human and mouse mRNAs encoding tumor necrosis factor (TNF-α) and a variety of other inflammatory mediators led to the suggestion that these AU-rich elements AREs) could be important for regulating gene expression [4]."<ref name=Siegel>{{ cite journal
+|author=David A. Siegel, Olivier Le Tonqueze, Anne Biton, Noah Zaitlen, and David J. Erle
+|title=Massively Parallel Analysis of Human 3′ UTRs Reveals that AU-Rich Element Length and Registration Predict mRNA Destabilization
+|journal=bioRxiv
+|date=12 February 2020
+|volume=
+|issue=
+|pages=
+|url=https://www.biorxiv.org/content/biorxiv/early/2020/02/12/2020.02.12.945063.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1101/2020.02.12.945063
+|pmid=
+|accessdate=23 March 2021 }}</ref>
-Positive strand, positive direction: 5'-ACGTGGC-3' at 4344 and complement.
+==Adr1ps==
+{{main|Adr1p gene transcriptions}}
+The upstream activating sequence (UAS) for Adr1p is 5'-TTGGGG-3' or 5'-TTGG(A/G)G-3'.<ref name=Tang/>
-===ABRE proximal promoters===
+==Aft1ps==
+{{main|Aft1p gene transcriptions}}
+The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).<ref name=Tang>{{ cite journal
+|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
+|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
+|journal=Metabolites
+|date=6 August 2020
+|volume=10
+|issue=8
+|pages=320-39
+|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
+|arxiv=
+|bibcode=
+|doi=10.3390/metabo10080320
+|pmid=32781665
+|accessdate=18 September 2020 }}</ref>
-Positive strand, negative direction: 5'-ACGTGGC-3' at 4239 and complement.
+==AGC boxes==
+{{Main|AGC box gene transcriptions}}
-===ABRE distal promoters===
+"The GCC box, also referred to as the '''AGC box''' (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."<ref name=Buttner>{{ cite journal
+|author=Michael Büttner and Karam B. Singh
-Negative strand, negative direction: 5'-GACACGT-3' at 3429 and complement.
+|title=''Arabidopsis thaliana'' ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein
+|journal=Proceedings of the National Academy of Sciences of the United States of America
-Positive strand, positive direction: 5'-GACACGT-3' at 2960, 5'-ACGTGTC-3' at 1823 and complements.
+|date=May 27, 1997
+|volume=94
-===ACE proximal promoters===
+|issue=11
+|pages=5961-6
-Negative strand, negative direction: 5'-ACGTG-3' at 4339 and complement.
+|url=http://www.pnas.org/content/94/11/5961.long
+|arxiv=
-Positive strand, negative direction: 5'-ACGTG-3' at 4237 and complement.
+|bibcode=
+|doi=
-===ACE distal promoters===
+|pmid=
+|accessdate=2014-05-02 }}</ref>
-Negative strand, negative direction: 5'-CACGT-3' at 3429, 5'-ACGTG-3' at 3288, 5'-CACGT-3' at 2863, 5'-ACGTG-3' at 2760, 5'-ACGTG-3' at 2425, 5'-CACGT-3' at 2081, 5'-ACGTG-3' at 1999, 5'-ACGTG-3' at 1718, 5'-CACGT-3' at 1535, 5'-CACGT-3' at 1470, 5'-ACGTG-3' at 1346, 5'-ACGTG-3' at 1338 and complements.
+==Androgen response elements==
+{{main|Androgen response element gene transcriptions}}
+"The androgen response element sequence, 5'-GGTACACGGTGTTCT-3', was obtained  from  the  National  Center  of  Biotechnology  Information (NCBI)."<ref name=Kouhpayeh>{{ cite journal
+|author=S Kouhpayeh, AR Einizadeh, Z Hejazi, M Boshtam, L Shariati, M Mirian, L Darzi, M Sojoudi, H Khanahmad and A Rezaei
+|title=Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line
+|journal=Cancer Gene Therapy
+|date=1 July 2016
+|volume=23
+|issue=
+|pages=254-257
+|url=https://www.researchgate.net/profile/Mina_Mirian/publication/304707422_Antiproliferative_effect_of_a_synthetic_aptamer_mimicking_androgen_response_elements_in_the_LNCaP_cell_line/links/59ffed00458515d0706e4f27/Antiproliferative-effect-of-a-synthetic-aptamer-mimicking-androgen-response-elements-in-the-LNCaP-cell-line.pdf
+|arxiv=
+|bibcode=
+|doi=10.1038/cgt.2016.26
+|pmid=
+|accessdate=3 October 2020 }}</ref>
-Negative strand, positive direction: 5'-CACGT-3' at 3254, 5'-ACGTG-3' at 570, 5'-CACGT-3' at 569, and complements.
+'-TGGAGAACAGCCTGTTCTCCA-3' or 5'-AGAACAGCCTGTTCT-3'<ref name=Wilson>{{ cite journal
+|author=Stephen Wilson, Jianfei Qi & Fabian V. Filipp
-Positive strand, negative direction: 5'-CACGT-3' at 1772, 5'-CACGT-3' at 531, 5'-CACGT-3' at 342, and complements.
+|title=Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines
+|journal=Scientific Reports
-Positive strand, positive direction: 5'-CACGT-3' at 3960, 5'-ACGTG-3' at 3884, 5'-CACGT-3' at 3883, 5'-CACGT-3' at 3464, 5'-ACGTG-3' at 3342, 5'-ACGTG-3' at 3321, 5'-ACGTG-3' at 2961, 5'-CACGT-3' at 2960, 5'-CACGT-3' at 2800, 5'-CACGT-3' at 2681, 5'-CACGT-3' at 2334, 5'-CACGT-3' at 2326, 5'-CACGT-3' at 2063, 5'-ACGTG-3' at 1821, 5'-CACGT-3' at 1786, 5'-ACGTG-3' at 1471, 5'-ACGTG-3' at 1371, 5'-ACGTG-3' at 1219, 5'-CACGT-3' at 1218, 5'-CACGT-3' at 783, 5'-ACGTG-3' at 547, 5'-CACGT-3' at 546, and complements.
+|date=14 September 2016
+|volume=6
-===Activating transcription factor (Burton) distal promoters===
+|issue=
+|pages=32611
+|url=https://www.nature.com/articles/srep32611
+|arxiv=
+|bibcode=
+|doi=10.1038/srep32611
+|pmid=
+|accessdate=3 October 2020 }}</ref> "Using the identified AREs within our experiment a refined extended canonical ARE model is proposed and deposited in transcription factor databases [...]."<ref name=Wilson/>
-Negative strand, positive direction: 5'-TGACGTAAG-3' at 2207 and complement.
+==Angiotensinogen core promoter elements==
+{{main|Angiotensinogen core promoter element gene transcriptions}}
-===cAMP response element proximal promoters===
+The consensus sequence is 5'-A/C-T-C/T-3'.<ref name=NSato>{{ cite journal
+|author=Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara
-Negative strand, negative direction: 5'-TGACGTCA-3' at 4317.
+|title=Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese
+|journal=Hypertension
-===C-box (Song) core promoters===
+|date=September 1997
+|volume=30
-Positive strand, positive direction: 5'-GACGTC-3' at 4316, and complement.
+|issue=3 Pt 1
+|pages=321-5
-===C-box (Song) proximal promoters===
+|url=http://www.ncbi.nlm.nih.gov/pubmed/9314411
+|arxiv=
-Negative strand, negative direction: 5'-GACGTC-3', 4316 and complement.
+|bibcode=
+|doi=10.1161/01.HYP.30.3.321
-===C-box (Song) distal promoters===
+|pmid=9314411
+|accessdate=2012-02-20 }}</ref> The core nucleotides for AGCE1 include 5'-A/C-T-C/T-G-T-G-3', "located between the TATA box and [[Transcription start site|transcription initiation site]] (positions −25 to −1) is an authentic regulator of human AG transcription."<ref name=Yanai>{{ cite journal
-Positive strand, positive direction: 5'-GACGTC-3' at 3280, 5'-GACGTC-3' at 3231, 5'-GACGTC-3' at 2858, 5'-GACGTC-3' at 1506, 5'-GACGTC-3' at 1120, 5'-GACGTC-3' at 532, 5'-GACGTC-3' at 437, 5'-GACGTC-3' at 193, and complements.
+|author=Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu
+|title=Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity
-===C/G-box hybrid (Song) distal promoters===
+|journal=The Journal of Biological Chemistry
+|date=28 November 1997
-Positive strand, positive direction: 5'-ACACGTCA-3' at 3962 and complement.
+|volume=272
+|issue=48
-===CRE box proximal promoters===
+|pages=30558-62
+|url=http://www.jbc.org/cgi/pmidlookup?view=long&pmid=9374551
+|arxiv=
+|bibcode=
+|doi=
+|pmid=9374551
+|accessdate=2012-02-20 }}</ref>
-Negative strand, negative direction: 5'-TGACGTCA-3', 4317, and complement.
+==Antioxidant-electrophile responsive elements==
+{{main|Antioxidant-electrophile responsive element gene transcriptions}}
-===Enhancer box distal promoters===
+'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3' is the consensus sequence of a functional antioxidant response element at the HIF1A locus.<ref name=Lacher>{{ cite journal
+|author=Sarah E. Lacher
-Negative strand, positive direction: 5'-CACGTG-3' at 570 and complement.
+|author2=Daniel C. Levings
+|author3=Samuel Freeman
-Positive strand, positive direction: 5'-CACGTG-3' at 3884 5'-CACGTG-3' at 2961, 5'-CACGTG-3' at 1219, 5'-CACGTG-3' at 547, and complements.
+|author4=Matthew Slattery
+|title=Identification of a functional antioxidant response element at the HIF1A locus
-===Initiator element (YYANWYY) core promoters===
+|journal=Redox Biology
+|date=October 2018
-Positive strand, positive direction: 5'-GACGTGG-3' at 4343 and complement.
+|volume=19
+|issue=
-===Initiator element (YYANWYY) proximal promoters===
+|pages=401-411
+|url=https://www.sciencedirect.com/science/article/pii/S2213231718305391
+|arxiv=
+|bibcode=
+|doi=10.1016/j.redox.2018.08.014
+|pmid=
+|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE).
-Negative strand, negative direction: 5'-GACGTGA-3' at 4340, and complement.
+==ATA boxes==
+{{main|ATA box gene transcriptions}}
+"The 3' flanking area contained the highly conserved hexanucleotide sequence A-A-T-A-A-A found in eukaryotic messages between the terminator codon and the polyadenylylation site (44)."<ref name=Liebhaber>{{ cite journal
+|author=Stephen A. Liebhaber, Michel J. Goossens, and Yuet Wai Kan
+|title=Cloning and complete nucleotide sequence of human 5'-α-globin gene
+|journal=Proceedings of the National Academy of Science USA
+|date=December 1980
+|volume=77
+|issue=12
+|pages=7054-8
+|url=http://www.pnas.org/content/77/12/7054.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|accessdate=2013-06-28 }}</ref>
-===Initiator element (YYANWYY) distal promoters===
+==AUUUA AREs==
+{{main|Adenylate–uridylate rich element gene transcriptions|AUUUA-containing AREs}}
+"Chen and Shyu [11] divided AREs into two classes of AUUUA-containing AREs and a third class of non-AUUUA AREs. Class I AUUUA-containing AREs had 1-3 copies of scattered AUUUA motifs coupled with a nearby U-rich region or U stretch, whereas class II AUUUA-containing AREs had at least two overlapping copies of the nonamer UUAUUUA(U/A)(U/A) in a U-rich region. Non-AUUUA AREs had a U-rich region and other unknown features, and the relationship of these sequences to AUUUA-containing AREs remains poorly understood. Subsequent studies based on analyses of a set of 4884 AUUUA-containing AREs led to a new classification based primarily on the number of overlapping AUUUA-repeats [8, 9, 10]. This classification system, with five clusters distinguished by the number of repeats, was used to identify AUUUA-containing AREs in the human genome. AREs identified using this classification were found to be abundant in 3′ UTRs of human genes."<ref name=Siegel/>
-Negative strand, negative direction: 5'-TTACGTC-3' at 3772, 5'-AACGTGA-3' at 3289, 5'-GACGTGG-3' at 2761, 5'-GACGTGA-3' at 2426, 5'-CCACGTC-3' at 2082, 5'-GACGTGA-3' at 2000, 5'-TCACGTT-5' at 1536, 5'-TCACGTC-3' at 1471, 5'-AACGTGA-3' at 1347, 5'-AACGTGG-3' at 1339, 5'-GACGTAA-3' at 152, and complements.
+==Auxin response factors==
+{{main|Auxin response factor gene transcriptions}}
+The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."<ref name=Stigliani>{{ cite journal
+|author=Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy
+|title=Capturing Auxin Response Factors Syntax Using DNA Binding Models
+|journal=Molecular Plant
+|date=3 June 2019
+|volume=12
+|issue=6
+|pages=822-832
+|url=https://www.sciencedirect.com/science/article/pii/S167420521830306X
+|arxiv=
+|bibcode=
+|doi=10.1016/j.molp.2018.09.010
+|pmid=30336329
+|accessdate=29 August 2020 }}</ref> "ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]. More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."<ref name=Stigliani/>
-Positive strand, negative direction: 5'-GACGTGG-3' at 4238, 5'-TCACGTC-3' at 1773, and complements.
+A more general consensus sequence may be 1(C/G/T)-2N-3(G/T)-4G-5(C/T)-6(C/T)-7N-8N-9N-10N, where ARF2[b] is 1(C/G/T)-2(A/C/T)-3(G/T)-4G-5(C/T)-6(C/T)-7(G/T)-8(C/G)-9(A/C/T)-10(A/G/T) and ARF5/MP[b] is 1(C/G/T)-2N-3(G/T)-4G-5T-6C-7(G/T)-8N-9-10N.<ref name=Stigliani/> ARF1[b] has 4G.<ref name=Stigliani/>
-Negative strand, positive direction: 5'-TCACGTC-3' at 3255, and complement.
+==B boxes==
+{{main|B box gene transcriptions}}
-Positive strand, positive direction: 5'-TCACGTC-3' at 3465, 5'-CTACGTC-3' at 3460, 5'-AACGTAG-3' at 3402, 5'-AACGTGA-3' at 3343, 5'-GACGTGG-3' at 3322, 5'-CCACGTT-3' at 2801, 5'-CCACGTT-3' at 2335, 5'-TCACGTC-3' at 2327, 5'-TCACGTC-3' at 2064, 5'-GACGTAA-3' at 2206, 5'-TCACGTC-3' at 1787, 5'-GACGTGA-3' at 1472, 5'-GACGTGA-3' at 1372, 5'-CCACGTC-3' at 784, and complement.
+While there appear to be at least two B boxes, TGGGCA is one B-box,<ref name=Johnson>{{ cite journal
+|author=PA Johnson, D Bunick, NB Hecht
+|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
+|journal=Biology of Reproduction
+|date=1991
+|volume=44
+|issue=1
+|pages=127-134
+|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
+|arxiv=
+|bibcode=
+|doi=10.1095/biolreprod44.1.127
+|pmid=2015343
+|accessdate=6 April 2019 }}</ref> where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the ''Dde'' I site at position -140 to the ''Dde'' I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."<ref name=Johnson/>
-===Initiator element (BBCABW) core promoters===
+The other is associated with the human transforming growth factor b1 binding sequences.<ref name=Paratore>{{ cite journal
+|author=Amber Paratore Sanchez and Kumar Sharma
+|title=Transcription factors in the pathogenesis of diabetic nephropathy
+|journal=Expert Reviews in Molecular Medicine
+|date=July 2009
+|volume=11
+|issue=
+|pages=e13
+|url=https://www.cambridge.org/core/journals/expert-reviews-in-molecular-medicine/article/transcription-factors-in-the-pathogenesis-of-diabetic-nephropathy/5459130CB955272C047982BE21FEE256
+|arxiv=
+|bibcode=
+|doi=10.1017/S1462399409001057
+|pmid=19397838
+|accessdate=1 October 2018 }}</ref>
-Positive strand, positive direction: 5'-TGACGT-3' at 4341, 5'-TGACGT-3' at 4338, 5'-TGACGT-3' at 4330, 5'-ACGTCT-3' at 4317, and complements.
+And, has the consensus sequence 5'-TGTCTCA-3'.
-===Initiator element (BBCABW) proximal promoters===
+==B recognition elements==
+{{main|Factor II B recognition element gene transcriptions}}
-Negative strand, negative direction: 5'-ACGTGA-3' at 4340, 5'-ACGTCA-3' at 4317, 5'-TGACGT-3' at 4315, and complements.
+The factor II B recognition element is BRE<sup>u</sup>.
-===Initiator element (BBCABW) distal promoters===
+"The transcription factor II B recognition elements BRE<sup>u</sup> "CGACGCA" and BRE<sup>d</sup> "ATGGTTG" were upstream (− 279 to − 273 of the transcript) and downstream (− 165 to − 159 of the transcript) of the TATA box, respectively."<ref name=Matsumoto>{{ cite journal
+|author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima
+|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
+|journal=Fisheries Science
+|date=9 August 2020
+|volume=86
+|issue=
+|pages=873-887
+|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
+|arxiv=
+|bibcode=
+|doi=10.1007/s12562-020-01451-z
+|pmid=
+|accessdate=27 September 2020 }}</ref>
-Negative strand, negative direction: 5'-TTACGT-3', 3771, 5'-ACGTCT-3' at 3431, 5'-ACACGT-3' at 3429, 5'-ACGTGA-3' at 3289, 5'-ACACGT-3' at 2863, 5'-TGACGT-3' at 2759, 53'-ACGTCA-3' at 2737, 5'-ACGTGA-3' at 2426, 5'-TGACGT-3' at 2424, 5'-ACGTCA-3' at 2402, 5'-ACGTCA-3' at 2083, 5'-ACGTGA-3' at 2000, 5'-TGACGT-3' at 1998, 5'-ACGTCA-3' at 1976, 5'-ACGTGT-3' at 1719, 5'-TCACGT-3' at 1535, 5'-TGACGT-3' at 1494, 5'-ACGTCA-3' at 1472, 5'-ACGTGA-3' at 1347, 5'-ACGTCA-3' at 1323, 5'-ACGTCA-3' at 1032, 5'-ACGTAA-3' at 152, and complements.
+The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.<ref name=Yang>{{ cite journal
+|author=Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez.
+|title=Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters
+|journal=Gene
+|date=March 7, 2007
+|volume=389
+|issue=1
+|pages=52-65
+|pmid=17123746
+|doi=10.1016/j.gene.2006.09.029
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1955227/?tool=pubmed }}</ref>
-Positive strand, negative direction: 5'-AGACGT-3' at 4236, 5'-ACGTCT-3' at 1774, 5'-TCACGT-3' at 1772, 5'-ACGTAA-3' at 533, 5'-ACACGT-3' at 531, 5'-ACACGT-3' at 342, and complements.
+The consensus sequence is 5’-G/C G/C G/A C G C C-3’.<ref name=Kutach>{{ cite journal
+|author=Alan K. Kutach, James T. Kadonaga
-Negative strand, positive direction: 5'-ACGTCT-3' at 3256, 5'-TCACGT-3' at 3254, 5'-ACACGT-3' at 569, and complements.
+|title=The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in ''Drosophila'' Core Promoters
+|journal=Molecular and Cellular Biology
+|date=July 2000
+|volume=20
+|issue=13
+|pages=4754-64
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC85905/pdf/mb004754.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=10848601
+|accessdate=2012-07-15 }}</ref>
-Positive strand, positive direction: 5'-ACGTCA-3' at 3962, 5'-ACACGT-3' at 3960, 5'-ACGTCT-3' at 3831, 5'-TCACGT-3' at 3464, 5'-ACGTCA-3' at 3461, 5'-ACGTGA-3' at 3343, 5'-TGACGT-3' at 3320, 5'-ACGTCA-3' at 3281, 5'-AGACGT-3' at 3279, 5'-AGACGT-3' at 3268, 5'-ACGTCA-3' at 3232, 5'-ACGTAA-3' at 3072, 5'-TTACGT-3' at 3070, 5'-AGACGT-3' at 3061, 5'-ACGTGT-3' at 2962, 5'-ACACGT-3' at 2960, 5'-ACGTCT-3' at 2859, 5'-AGACGT-3' at 2857, 5'-ACGTCT-3' at 2721, 5'-ACACGT-3' at 2681, 5'-ACGTCA-3' at 2328, 5'-TCACGT-3' at 2326, 5'-ACGTAA-3' at 2206, 5'-TGACGT-3' at 2204, 5'-ACGTCA-3' at 2065, 5'-TCACGT-3' at 2063, 5'-ACGTCT-3' at 1937, 5'-ACGTGT-3' at 1822, 5'-TCACGT-3' at 1786, 5'-TGACGT-3' at 1505, 5'-ACGTGA-3' at 1472, 5'-ACGTGA-3' at 1372, 5'-ACGTGT-3' at 1220, 5'-ACGTGT-3' at 548, 5'-ACGTCT-3' at 438, 5'-AGACGT-3' at 224, and complements.
+==CadC binding domains==
+{{main|CadC binding domain gene transcriptions}}
+"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."<ref name=Schlundt>{{ cite journal
+|author=Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler
+|title=Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator
+|journal=Scientific Reports
+|date=21 April 2017
+|volume=7
+|issue=
+|pages=1051
+|url=https://www.nature.com/articles/s41598-017-01031-9/briefing/signup/
+|arxiv=
+|bibcode=
+|doi=10.1038/s41598-017-01031-9
+|pmid=28432336
+|accessdate=28 August 2020 }}</ref> "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites."<ref name=Schlundt/> "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."<ref name=Schlundt/>
-===MRE proximal promoters===
+==Calcineurin-responsive transcription factors==
+{{main|Calcineurin-responsive transcription factor gene transcriptions}}
-Negative strand, negative direction: 5'-ACGTGAG-3' at 4341 and complement.
+The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p) is 5'-TG(A/C)GCCNC-3'.<ref name=Tang/>
-===MRE distal promoters===
+==Carbohydrate response elements==
+{{main|Carbohydrate response element gene transcriptions}}
+"The putative ChREBP binding sites [are] ChoRE1 (CACGTG<u>ACCGG</u>ATCTTG, -324 to -308) and ChoRE2 (TCCGCC<u>CCCAT</u>CACGTG, -298 to - 282) [...], where the 5-nt spacer [Carb and Carb1 is] between the two E-boxes in ChoRE motifs [CarbE1, CarbE2 and CarbE3]."<ref name=Long2020>{{ cite journal
+|author=Jianyin Long
+|author2=Daniel L. Galvan
+|author3=Koki Mise
+|author4=Yashpal S. Kanwar
+|author5=Li Li
+|author6=Naravat Poungavrin
+|author7=Paul A. Overbeek
+|author8=Benny H. Chang
+|author9=Farhad R. Danesh
+|title=Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1
+|journal=Journal of Biological Chemistry
+|date=28 May 2020
+|volume=5
+|issue=28
+|pages=
+|url=https://www.jbc.org/content/early/2020/05/28/jbc.RA120.013228.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.RA120.013228
+|pmid=
+|accessdate=6 October 2020 }}</ref>
-Negative strand, negative direction: 5'-ACGTGAG-3' at 3290, 5'-CACACGT-3' at 2863, 5'-ACGTGGG-3' at 2762, 5'-ACGTGAG-3' at 2427, 5'-ACGTGAG-3' at 2001, 5'-CTCACGT-3' at 1470, 5'-ACGTGAG-3' at 1348, and complements.
+==CAREs==
+{{main|CARE gene transcriptions}}
+"GARE and a novel CARE (CAACTC regulatory elements) elements are present in the promoter of rice ''RAmy1A'' (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003)."<ref name=Fan>{{ cite journal
+|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
+|title=Gibberellin Signal Transduction in Rice
+|journal=Journal of Integrative Plant Biology
+|date=2007
+|volume=49
+|issue=6
+|pages=731−741
+|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
+|arxiv=
+|bibcode=
+|doi=10.1111/j.1744-7909.2007.00511.x
+|pmid=
+|accessdate=16 October 2018 }}</ref>
-Positive strand, negative direction: 5'-ACGTGGG-3' at 3323, 5'-ACGTGTG-3' at 2963, 5'-CTCACGT-3' at 1772, 5'-ACGTGAG-3' at 1473, 5'-ACGTGAG-3' at 1373, 5'-ACGTGTG-3' at 1221, 5'-ACGTGTG-3' at 549, 5'-CACACGT-3' at 531, and complements.
+==CArG boxes==
+{{main|CArG box gene transcriptions}}
-Positive strand, positive direction: 5'-CCCACGT-3' at 3883, 5'-CCCACGT-3' at 2800, 5'-CTCACGT-3' at 2326, 5'-CTCACGT-3' at 1786, 5'-CGCACGT-3' at 1218, 5'-CGCACGT-3' at 546, and complements.
+"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of [[MADS box gene transcriptions|MADS box]] proteins (Ito et al., 2008)."<ref name=Fujisawa>{{ cite journal
+|author=Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito
-===Phop distal promoters===
+|title=A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening
+|journal=The Plant Cell
-Negative strand, negative direction: 5'-AACGTG-3' at 3288, 3'-CACGTT-5' at 2864, 5'-AACGTG-3' at 1718, 3'-CACGTT-5' at 1536, 5'-AACGTG-3' at 1346, 5'-AACGTG-3' at 1338 and complements.
+|date=5 February 2013
+|volume=25
-Positive strand, negative direction: 5'-CACGTT-3' at 343 and complements.
+|issue=2
+|pages=371-86
+|url=http://www.plantcell.org/content/25/2/371.short
+|arxiv=
+|bibcode=
+|doi=10.1105/tpc.112.108118
+|pmid=23386264
+|accessdate=2017-02-19 }}</ref>
-Negative strand, positive direction: 5'-CACGTG-3' at 570 and complement.
+"MADS-box proteins bind to a consensus sequence, the CArG box, that has the core motif CC(A/T)<sub>6</sub>GG (15)."<ref name=Deng/>
+"Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [...]."<ref name=Deng>{{ cite journal
+|author=Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis
+|title=FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis
+|journal=Proceedings of the National Academy of Sciences United States of America
+|date=19 April 2011
+|volume=108
+|issue=16
+|pages=6680–6685
+|url=http://www.pnas.org/content/108/16/6680.short
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.1103175108
+|pmid=
+|accessdate=2017-09-17 }}</ref>
-Positive strand, positive direction: 5'-CACGTG-3' at 3884, 5'-CACGTG-3' at 2961, 5'-CACGTT-3' at 2801, 5'-CACGTT-3' at 2335, 5'-CACGTG-3' at 1219, 5'-CACGTG-3' at 547 and complements.
+Three "other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."<ref name=Deng/> These together with the core motif CC(A/T)<sub>6</sub>GG (15) suggest a more general CArG-box motif of (C(C/A/T)(A/T)<sub>6</sub>(A/G)G).
-===Z box distal promoters===
+==Cat8p gene transcriptions==
+{{main|Cat8p gene transcriptions}}
-Positive strand, positive direction: 5'-ACACGTGT-3' at 2962 and complement.
+The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T, B = C, G, T, V = A, C, G, M = A, C, and H = A, C, T; i.e. 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'.<ref name=Tang/>
-==Activating protein 2==
+==CAT boxes==
-{{main|Activating protein gene transcriptions}}
+{{main|CAT box gene transcriptions}}
-"AP-2 proteins can bind to G/C-rich elements, such as 5’-[G/C]CCN(3,4)GG[G/C]-3’ (41, 42)."<ref name=Murata>{{ cite journal
+"The M-CAT consensus sequence [is] CATTCCT".<ref name=Berberich/>
-|author=Takayuki Murata, Chieko Noda, Yohei Narita1, Takahiro Watanabe, Masahiro Yoshida, Keiji Ashio, Yoshitaka Sato, Fumi Goshima, Teru Kanda, Hironori Yoshiyama, Tatsuya Tsurumi, and Hiroshi Kimura
-|title=Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)
+"A [chloramphenicol acetyltransferase] CAT-box-like element, GCCATT [34], adjacent to the GC-box, is conserved in the three promoters."<ref name=Berberich>{{ cite journal
-|journal=Journal of Virology
+|author=Christof Berberich, Ingolf Dürr, Michael Koenen and Veit Witzemann
-|date=27 January 2016
+|title=Two adjacent E box elements and a M‐CAT box are involved in the muscle‐specific regulation of the rat acetylcholine receptor β subunit gene
-|volume=
+|journal=European Journal of Biochemistry
-|issue=
+|date=September 1993
-|pages=
+|volume=216
-|url=https://jvi.asm.org/content/jvi/early/2016/01/21/JVI.03227-15.full.pdf
+|issue=2
+|pages=395-404
+|url=https://febs.onlinelibrary.wiley.com/doi/pdf/10.1111/j.1432-1033.1993.tb18157.x
 |arxiv=
 |bibcode=
-|doi=10.1128/JVI.03227-15
+|doi=10.1111/j.1432-1033.1993.tb18157.x
 |pmid=
-|accessdate=4 October 2020 }}</ref>
+|accessdate=27 December 2019 }}</ref>
-Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC.<ref name=Cohen>{{ cite journal
+==C boxes==
-|author=Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo
+{{main|C box gene transcriptions}}
-|title=Structural characterization of the complete human perlecan gene and its promoter
+"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C-box) [...]."<ref name=Zhang2014/>
-|journal=Proceedings of the National Academy of Sciences USA
-|date=1 November 1993
+Analysis "of the recombinant (soybean [''Glycine max''] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."<ref name=Song>{{ cite journal
-|volume=90
+|author=Young Hun Song
-|issue=21
+|author2=Cheol Min Yoo
-|pages=10404-10408
+|author3=An Pio Hong
-|url=https://www.pnas.org/content/pnas/90/21/10404.full.pdf
+|author4=Seong Hee Kim
+|author5=Hee Jeong Jeong
+|author6=Su Young Shin
+|author7=Hye Jin Kim
+|author8=Dae-Jin Yun
+|author9=Chae Oh Lim
+|author10=Jeong Dong Bahk
+|author11=Sang Yeol Lee
+|author12=Ron T. Nagao
+|author13=Joe L. Key
+|author14=Jong Chan Hong
+|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
+|journal=Plant Physiology
+|date=April 2008
+|volume=146
+|issue=4
+|pages=1862–1877
+|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
 |arxiv=
 |bibcode=
-|doi=10.1073/pnas.90.21.10404
+|doi=10.1104/pp.107.113217
-|pmid=8234307
+|pmid=18287490
-|accessdate=6 September 2020 }}</ref>
+|accessdate=26 March 2019 }}</ref>
-===Activating protein (Murata) core promoters===
+The human ribosomal protein L11 gene (''HRPL11'') has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].<ref name=Voronina>{{ cite journal
+|author=E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko
-Negative strand, positive direction: 5'-CCCTGGGGC-3' at 4427, 5'-CCCTTGGGG-3' at 4302 and complement.
+|title=Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
+|journal=Molecular Biology
-===Activating protein (Murata) proximal promoters===
+|date=2003
+|volume=37
-Negative strand, positive direction: 5'-CCCATGGGG-3' at 4224, 5'-CCCCATGGG-3' at 4223, and complements.
+|issue=3
+|pages=362–371
+|url=https://www.researchgate.net/profile/Elena_Voronina3/publication/263607045_Structural-Functional_Analysis_of_the_Human_Gene_for_Ribosomal_Protein_L11/links/5523af480cf27b5dc3795afa.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|accessdate=11 April 2019 }}</ref>
-===Activating protein (Murata) distal promoters===
+"Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA)."<ref name=Samarsky>{{ cite journal
+|author=Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand
+|title=The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization
+|journal=The European Molecular Biology Organization (EMBO) Journal
+|date=1 July 1998
+|volume=17
+|issue=13
+|pages=3747–3757
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1170710/pdf/003747.pdf
+|arxiv=
+|bibcode=
+|doi=10.1093/emboj/17.13.3747
+|pmid=9649444
+|accessdate=2017-02-04 }}</ref>
-Negative strand, negative direction: 5'-CCCTGCGGC-3' at 1154 and complement.
+Substituting T for U yields C box = 5'-AGTAGT-3' in the translation direction on the template strand.
-Negative strand, positive direction: 5'-GCCCTGGGC-3' at 3498, 5'-GCCAATGGG-3' at 2911, 5'-GCCTCTGGC-3' at 2884, 5'-CCCTTAGGG-3' at 2766, 5'-GCCACCGGC-3' at 1547, 5'-GCCACCGGC-3' at 1295, 5'-GCCAGCGGC-3' at 332, 5'-CCCTCAGGC-3' at 91, and complements.
+==CCAAT-box-binding transcription factors==
+{{main|Nuclear factor gene transcriptions}}
+The upstream activating sequence (UAS) for the Hap4p is 5'-CCAAT-3'.<ref name=Tang/>
-Positive strand, negative direction: 5'-CCCAAGGGC-3' at 1820 and complement.
+==Cell-cycle boxes==
+{{main|Cell-cycle box gene transcriptions}}
-Positive strand, positive direction: 5'-CCCGTTGGC-3' at 3912, 5'-CCCTGTGGG-3' at 3533, 5'-GCCAACGGG-3' at 3493, 5'-CCCAGAGGC-3' at 1961, 5'-GCCGGTGGG-3' at 1852, 5'-GCCCGCGGG-3' at 1770, 5'-CCCGGCGGC-3' at 1758, 5'-GCCCCCGGC-3' at 1647, 5'-CCCGACGGC-3' at 483, 5'-CCCTCCGGG-3' at 372, and complements.
+"The 5' non-coding part contains the sequence elements characteristic for eukaryotic promoters such as TATA and CAAT boxes as well as an inverted motif typical for cell-cycle regulated genes named "cell-cycle box" (CCB). The consensus sequence of CCB is CACGAAAA (Nasmyth, 1985), however, more relaxed variants such as CACGAAA, ACGAAA and C-CGAAA were described in budding yeast CLN1 and CLN2 (Ogas ''et al'', 1991)."<ref name=Deckert>{{ cite book
+|author=Joanna Deckert, Natasha Taranenko, and Peter M. Gresshoff
+|title=Cell Cycle Genes and Their Plant Homologues, In: ''Plant Genome Analysis: Current Topics in Plant Molecular Biology''
+|publisher=CRC Press, Inc.
+|location=2000 Corporate Blvd., N.W., Boca Raton, Florida 33431
+|date=1994
+|editor=Peter M. Gresshoff
+|pages=169-194
+|url=https://books.google.com/books?hl=en&lr=&id=uHf8DwAAQBAJ&oi=fnd&pg=PA169&ots=9IjOcr07O_&sig=ytbcs2isNOs3HLkVKzqRPFME1mk#v=onepage&q&f=false
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|isbn=0-8493-8264-5
+|accessdate=19 April 2021 }}</ref>
-===Activating protein (Cohen) distal promoters===
+==CGCG boxes==
+{{main|CGCG box gene transcriptions}}
+"The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T)."<ref name=Yang>{{ cite journal
+|author=Tianbao Yang and B. W. Poovaiah
+|title=A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants
+|journal=Journal of Biological Chemistry
+|date=22 November 2002
+|volume=277
+|issue=47
+|pages=45049-45058
+|url=http://www.jbc.org/content/277/47/45049.full
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.M207941200
+|pmid=
+|accessdate=2017-02-05 }}</ref>
-Negative strand, negative direction: 5'-CCGGTCCG-3' at 4103, 5'-CGGACCGG-3' at 3130, 5'-CCGGTCCG-3' at 2520, 5'-CGGACCGG-3' at 1200, 5'-CCGGTCCG-3' at 649 and complements.
+==Circadian control elements==
+{{main|Circadian control element gene transcriptions}}
+"The circadian control element (circadian; Anderson ''et al.'', 1994) was found in 10 FvTCP genes."<ref name=Wei>{{ cite journal
+|author=Wei Wei, Yang Hu, Meng-Yuan Cui, Yong-Tao Han, Kuan Gao, and Jia-Yue Feng
+|title=Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry ''Fragaria vesca''
+|journal=Frontiers in Plant Science
+|date=22 December 2016
+|volume=7
+|issue=
+|pages=1937
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5177655/#B2
+|arxiv=
+|bibcode=
+|doi=10.3389/fpls.2016.01937
+|pmid=28066489
+|accessdate=29 November 2020 }}</ref>
-Negative strand, positive direction: 5'-GCCTGGCC-3' at 3681, 5'-GCCTGGCC-3' at 2990, 5'-GGCCAGGC-3' at 1176 and complements.
+Circadian control elements (CAANNNNATC).<ref name=Sharma/>
-===Activating protein (Cohen2) distal promoters===
+==Class C DNA binding sites==
+{{main|N box gene transcriptions}}
+The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.<ref name=Leal>{{ cite journal
+|author=María C. Leal, Ezequiel I. Surace, María P. Holgado, Carina C. Ferrari, Rodolfo Tarelli, Fernando Pitossi, Thomas Wisniewski, Eduardo M. Castaño, and Laura Morelli
+|title=Notch signaling proteins HES-1 and Hey-1 bind to insulin degrading enzyme (IDE) proximal promoter and repress its transcription and activity: Implications for cellular Aβ metabolism
+|journal=Biochim Biophys Acta
+|date=19 October 2011
+|volume=1823
+|issue=2
+|pages=227-235
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3307219/
+|arxiv=
+|bibcode=
+|doi=10.1016/j.bbamcr.2011.09.014
+|pmid=22036964
+|accessdate=21 March 2021 }}</ref>
-Positive strand, positive direction: 5'-TCCCCCGCCC-3' at 4440 and complement.
+==Cold-responsive elements==
+{{main|Cold-responsive element gene transcriptions}}
-===Activating protein (Yao1) proximal promoters===
+A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."<ref name=Pietzenuk>{{ cite journal
+|author=Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka
-Positive strand, positive direction: 5'-CCCTTCT-3' at 4264 and complement.
+|title=Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements
+|journal=Genome Biology
-===Activating protein (Yao1) distal promoters===
+|date=11 October 2016
+|volume=17
-Negative strand, negative direction: 5'-TCTTCCC-3' at 1657, 5'-GGGAAGA-3' at 620 and complements.
+|issue=
+|pages=209
-===Activating protein (Yao2) core promoters===
+|url=https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-1072-3
+|arxiv=
-Negative strand, negative direction: 5'-ACCCTC-3' at 4549, 5'-ACCCTC-3' at 4497 and complements.
+|bibcode=
+|doi=10.1186/s13059-016-1072-3
-===Activating protein (Yao2) proximal promoters===
+|pmid=
+|accessdate=14 September 2020 }}</ref>
-Negative strand, negative direction: 5'-ACCCTC-3' at 4303, 5'-ACCCTC-3' at 4271, 5'-GAGGGT-3' at 4259, 5'-ACCCTC-3' at 4153 and complements.
+==Copper response elements==
+{{main|Copper response element gene transcriptions}}
+"''Chlamydomonas reinhardtii'' activates the transcription of the ''Cyc6'' and the ''Cpx1'' genes (encoding cytochrome ''c<sub>6</sub>'' and coprogen oxidase) in response to copper deficiency."<ref name=Quinn/>
-===Activating protein (Yao2) distal promoters===
+"A consensus copper-response element [CuRE] TTTGC(T/G)C(A/G) (12) is a binding site for Mac1p."<ref name=Quinn>{{ cite journal
+|author=Jeanette M. Quinn, Paola Barraco, Mats Eriksson and Sabeeha Merchant
+|title=Coordinate Copper- and Oxygen-responsive ''Cyc6'' and ''Cpx1'' Expression in ''Chlamydomonas'' Is Mediated by the Same Element
+|journal=Journal of Biological Chemistry
+|date=March 2000
+|volume=275
+|issue=9
+|pages=6080-6089
+|url=https://www.sciencedirect.com/science/article/pii/S0021925818304551
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.275.9.6080
+|pmid=
+|accessdate=1 April 2021 }}</ref>
-Negative strand, negative direction: 5'-ACCCTC-3' at 3989, 5'-ACCCTC-3' at 3752, 5'-ACCCTC-3' at 3714, 5'-ACCCTC-3' at 3080, 5'-ACCCTC-3' at 2221, 5'-ACCCTC-3' at 2104, 5'-ACCCTC-3' at 1962, 5'-ACCCTC-3' at 1930, 5'-ACCCTC-3' at 1795, 5'-ACCCTC-3' at 1018, 5'-ACCCTC-3' at 686, 5'-ACCCTC-3' at 550, 5'-ACCCTC-3' at 413, 5'-GAGGGT-3' at 389 and complements.
+"An additional EMSA result demonstrated that [''Aspergillus fumigatus'' (Af)] AfMac1 directly binds to a copper response element in the promoter regions of the ''ctrA2'' and ''ctrC'' genes with a defined consensus DNA motif (5′-TGTGCTCA-3′) (Park et al., 2017<ref name=Park>{{ cite journal
+|author=Yong-Sung Park, Tae-Hyoung Kim and Cheol-Won Yun
+|title=Functional characterization of the copper transcription factor AfMac1 from ''Aspergillus fumigatus''
+|journal=Biochemical Journal
+|date=3 July 2017
+|volume=474
+|issue=14
+|pages=2365-2378
+|url=https://portlandpress.com/biochemj/article-abstract/474/14/2365/49495/Functional-characterization-of-the-copper?redirectedFrom=fulltext
+|arxiv=
+|bibcode=
+|doi=10.1042/BCJ20170191
+|pmid=
+|accessdate=2 April 2021 }}</ref>), which is strikingly similar to the Mac1-binding motif in ''S. cerevisiae'' (Jamison McDaniels et al., 1999; Keller et al., 2000), suggesting that the mechanism of Mac1-mediated copper homeostasis may be conserved across fungal species."<ref name=Song>{{ cite journal
+|author=Jinxing Song, Rongpeng Li and Jihong Jiang
+|title=Copper Homeostasis in ''Aspergillus fumigatus'': Opportunities for Therapeutic Development
+|journal=Frontiers in Microbiology
+|date=12 April 2019
+|volume=10
+|issue=
+|pages=774
+|url=https://www.frontiersin.org/articles/10.3389/fmicb.2019.00774/full
+|arxiv=
+|bibcode=
+|doi=10.3389/fmicb.2019.00774
+|pmid=
+|accessdate=2 April 2021 }}</ref>
-Negative strand, positive direction: 5'-CTCCCA-3' at 3333, 5'-CTCCCA-3' at 2532, 5'-CTCCCA-3' at 2396, 5'-CTCCCA-3' at 2383, 5'-TGGGAG-3' at 1782, 5'-CTCCCA-3' at 466 and complements.
+==Coupling elements==
+{{main|Coupling element gene transcriptions}}
+"In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996)."<ref name=Watanabe/>
-Positive strand, positive direction: 5'-CTCCCA-3' at 3880, 5'-CTCCCA-3' at 2797, 5'-CTCCCA-3' at 182.
+"In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."<ref name=Watanabe/>
-==Activating transcription factors==
+"To identify potential ''cis''-regulatory elements in the promoter sequences of ZmGRXCC genes, the 1500 bp sequences of each [maize CC-type glutaredoxin (GRX)] ZmGRXCC gene upstream of the ATG start codon were selected from the maize genome as the promoter, and the promoter sequence was screened using PlantCARE [32]. The elements searched included [...] CE3 (coupling element 3, -CACGCG-) for ABA responsiveness [...]."<ref name=Ding>{{ cite journal
-{{main|Activating transcription factor gene transcriptions}}
+|author=Shuangcheng Ding, Fengyu He, Wenlin Tang, Hewei Du and Hongwei Wang
-"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."<ref name=Burton>{{ cite journal
+|title=Identification of Maize CC-Type Glutaredoxins That Are Associated with Response to Drought Stress
-|author=Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud
+|journal=Genes
-|title=The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4
+|date=12 August 2019
-|journal=Journal of Biological Chemistry
+|volume=10
-|date=22 May 2020
+|issue=610
-|volume=295
+|pages=1-15
-|issue=21
+|url=https://www.mdpi.com/2073-4425/10/8/610/pdf
-|pages=7418
-|url=https://www.jbc.org/content/early/2020/04/20/jbc.RA119.011864.full.pdf
 |arxiv=
 |bibcode=
-|doi=10.1074/jbc.RA119.011864
+|doi=10.3390/genes10080610
-|pmid=32312748
+|pmid=
-|accessdate=5 September 2020 }}</ref>
+|accessdate=30 November 2020 }}</ref>
-===Activating transcription factor (Burton) distal promoters===
+==CRE boxes==
+{{main|CRE box gene transcriptions}}
+"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."<ref name=Montminy>{{ cite journal
+|author=Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman
+|title=Identification of a cyclic-AMP-responsive element within the rat somatostatin gene
+|journal=Proceedings of the National Academy of Sciences of the USA
+|date=September 1986
+|volume=83
+|issue=18
+|pages=6382-6
+|url=http://www.pnas.org/content/pnas/83/18/6682.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=2875459
+|accessdate=17 September 2018 }}</ref>
-Positive strand, negative direction: 5'-ATTTCATCA-3' at 2888, 5'-TGACGAAAC-3' at 313 and complement.
+The upstream activating sequence (UAS) for the Aca1p, the basic "leucine zipper (bZIP) transcription factor [55] involved in carbon source utilization" is 5'-TGACGTCA-3'<ref name=Tang/> the same as a CRE.
-Negative strand, positive direction: 5'-CTTGCGTCA-3' at 2423, 5'-TGACGTAAG-3' at 2207, 5'-TGATGAAAC-3' at 2147, 5'-CTTTCGTCA-3' at 1184 and complements.
+The upstream activating sequence (UAS) for the Sko1p, involved "in osmotic and oxidative stress responses" is 5'-TGACGTCA-3'<ref name=Tang/> the same as a CRE.
-===Activating transcription factor (Kilberg) distal promoters===
+[[Root specific element gene transcriptions|Root specific elements]] are the same as CREs.
-Positive strand, negative direction: 5'-ATTTCATCA-3' at 2888 and complement.
+==Cytokinin response regulators==
+{{main|Cytokinin response regulator gene transcriptions}}
+"Cytokinin fulfills its diverse roles in planta through a series of transcriptional responses."<ref name=Xiel>{{ cite journal
+|author=Mingtang Xie1, Hongyu Chen, Ling Huang, Ryan C. O’Neil1, Maxim N. Shokhirev & Joseph R. Ecker
+|title=A B-ARR-mediated cytokinin transcriptional network directs hormone cross-regulation and shoot development
+|journal=Nature Communications
+|date=23 April 2018
+|volume=9
+|issue=1604
+|pages=1-13
+|url=https://www.nature.com/articles/s41467-018-03921-6.pdf?origin=ppub
+|arxiv=
+|bibcode=
+|doi=10.1038/s41467-018-03921-6
+|pmid=
+|accessdate=26 April 2021 }}</ref>
-Negative strand, positive direction: 5'-TGATGAAAC-3' at 2147 and complement.
+"Cytokinin employs a two-component multi-step phosphorelay for its perception and signaling transduction<sup>12–14</sup>. In Arabidopsis, there are three cytokinin receptors (ARABIDOPSIS HISTIDINE KINASEs; AHK2, 3, 4) and eleven type-B response regulators (ARABIDOSPIS RESPONSE REGULATORs; B-ARRs)<sup>8,15</sup>."<ref name=Xiel/>
-==Adr1ps==
+"The cytokinin transcriptional response centrally affects the family of ARRs. Type-B ARRs (B-ARRs) are transcription factors (TFs) with a GARP-like DNA binding domain at their C-termini and a receiver domain at their N-termini. Type-A ARRs (A-ARRs) are similar to the N-termini receiver domain of B-ARRs but do not possess a DNA binding domain."<ref name=Xiel/>
-{{main|Adr1p gene transcriptions}}
-The upstream activating sequence (UAS) for Adr1p is 5'-TTGGGG-3' or 5'-TTGG(A/G)G-3'.<ref name=Tang/>
-===ADR core promoters===
+==Cytoplasmic polyadenylation elements==
+{{main|Cytoplasmic polyadenylation element gene transcriptions}}
+"The most well-understood mechanism for controlling cytoplasmic polyadenylation is regulation of mRNAs containing the cytoplasmic polyadenylation element (CPE; consensus UUUUUAU) by CPE-binding protein (CPEB)1."<ref name=Lin>{{ cite journal
+|author=Andrew C Lin, Chin Lik Tan, Chien-Ling Lin, Laure Strochlic, Yi-Shuian Huang, Joel D Richter & Christine E Holt
+|title=Cytoplasmic polyadenylation and cytoplasmic polyadenylation element-dependent mRNA regulation are involved in Xenopus retinal axon development
+|journal=Neural Development
+|date=2 March 2009
+|volume=4
+|issue=
+|pages=8
+|url=
+|arxiv=
+|bibcode=
+|doi=10.1186/1749-8104-4-8
+|pmid=
+|accessdate=17 April 2021 }}</ref>
-Negative strand, positive direction: 5'-TTGGGG-3' at 4302, and complement.
+"Cytoplasmic polyadenylation is determined by the cytoplasmic polyadenylation element (CPE; consensus sequence UUUUUAU) that resides in mRNA 3′ untranslated regions (UTRs)."<ref name=Ivshina>{{ cite journal
+|author=Maria Ivshina, Paul Lasko, and Joel D. Richter
+|title=Cytoplasmic polyadenylation element binding proteins in development, health, and disease
+|journal=Annual Review of Cell and Developmental Biology
+|date=October 2014
+|volume=30
+|issue=
+|pages=393-415
+|url=https://www.annualreviews.org/doi/abs/10.1146/annurev-cellbio-101011-155831
+|arxiv=
+|bibcode=
+|doi=10.1146/annurev-cellbio-101011-155831
+|pmid=
+|accessdate=17 April 2021 }}</ref>
-===ADR distal promoters===
+==DAF-16 binding elements==
+{{main|DAF-16 binding element gene transcriptions}}
+"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)<sup>11–13</sup>."<ref name=Li2017>{{ cite journal
+|author=Jun Li, Ana Carolina Dantas Machado, Ming Guo, Jared M. Sagendorf, Zhan Zhou, Longying Jiang, Xiaojuan Chen, Daichao Wu, Lingzhi Qu, Zhuchu Chen, Lin Chen, Remo Rohs, and Yongheng Chen
+|title=Structure of the forkhead domain of FOXA2 bound to a complete DNA consensus site
+|journal=Biochemistry
+|date=25 July 2017
+|volume=56
+|issue=29
+|pages=3745-3753
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5614898/
+|arxiv=
+|bibcode=
+|doi=10.1021/acs.biochem.7b00211
+|pmid=28644006
+|accessdate=28 August 2020 }}</ref>
-Negative strand, negative direction: 5'-CCCCAA-3' at 3803, 5'-TTGGAG-3' at 3786, 5'-CTCCAA-3' at 3260, 5'-TTGGGG-3' at 3150, 5'-AACCTC-3' at 3118, 5'-AACCCC-3' at 2923, 5'-TTGGGG-3' at 2623, 5'-CTCCAA-3' at 2397, 5'-TTGGGG-3' at 2286, 5'-TTGGGG-3' at 1859, 5'-CTCCAA-3' at 1318, 5'-TTGGGG-3' at 1216, 5'-CTCCAA-3' at 1027, 5'-CTCCAA-3' at 861, 5'-TTGGGG-3' at 616, and complements.
+==D boxes==
+{{main|C and D box gene transcriptions}}
+{{main|D box gene transcriptions}}
+There is one D box 5'-AGTCTG-3'.<ref name=Samarsky/>
-Positive strand, negative direction: 5'-TTGGAG-3' at 3118, 5'-TTGGGG-3' at 2923, and complements.
+The human ribosomal protein L11 gene (''HRPL11'') has two potential snRNA-coding sequences in intron 4: a D box beginning at +4237 (TCCTG).<ref name=Voronina>{{ cite journal
+|author=E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko
-Negative strand, positive direction: 5'-TTGGGG-3' at 2285, 5'-CTCCAA-3' at 1278, 5'-CTCCAA-3' at 942, 5'-CTCCAA-3' at 842, 5'-CTCCAA-3' at 606, 5'-CCCCAA-3' at 176, and complements.
+|title=Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
+|journal=Molecular Biology
-Positive strand, positive direction: 5'-TTGGGG-3' at 3939, 5'-CTCCAA-3' at 1925, 5'-TTGGAG-3' at 1618, 5'-TTGGAG-3' at 610, 5'-CTCCAA-3' at 304, and complements.
+|date=2003
+|volume=37
-==Aft1ps==
+|issue=3
-{{main|Aft1p gene transcriptions}}
+|pages=362–371
-The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).<ref name=Tang>{{ cite journal
+|url=https://www.researchgate.net/profile/Elena_Voronina3/publication/263607045_Structural-Functional_Analysis_of_the_Human_Gene_for_Ribosomal_Protein_L11/links/5523af480cf27b5dc3795afa.pdf
-|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
-|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
-|journal=Metabolites
-|date=6 August 2020
-|volume=10
-|issue=8
-|pages=320-39
-|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
 |arxiv=
 |bibcode=
-|doi=10.3390/metabo10080320
+|doi=
-|pmid=32781665
+|pmid=
-|accessdate=18 September 2020 }}</ref>
+|accessdate=11 April 2019 }}</ref>
-===AFT distal promoters===
+A D-box is (TGAGTGG).<ref name=Motojima/>
-{{main|Distal promoter gene transcriptions}}
-Negative strand, negative direction: 5'-TGGGTGTG-3' at 1804, and complement.
-Positive strand, negative direction: 5'-TGGGTGTG-3' at 3185, 5'-CGGGTGCG-3' at 2196, 5'-CGGGTGCG-3' at 379, and complements.
+==DNA damage response elements==
+{{main|DNA damage response element gene transcriptions}}
+"A consensus sequence, 5'-TAGCCGCCGRRRR-3' (where R = an unspecified purine nucleoside [A/G],was generated from these data."<ref name=Sumrada>{{ cite journal
+|author=Roberta A. Sumrada and Terrance G. Cooper
+|title=Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast
+|journal=Proceedings of the National Academy of Sciences USA
+|date=June 1987
+|volume=84
+|issue=
+|pages=3997-4001
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC305008/pdf/pnas00277-0054.pdf
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.84.12.3997
+|pmid=3295874
+|accessdate=6 September 2020 }}</ref>
-Negative strand, positive direction: 5'-TGCACCCG-3' at 3324 and complement.
+"The extent of homology for the entire 13 bp ranged from 56 to 100%. However, for the symmetrical core sequence CCGCC 75 to 100% homology was observed with only conservative substitutions occurring in the nonhomologous positions."<ref name=Sumrada/>
-==AGC boxes==
+==Downstream B recognition elements==
-{{Main|AGC box gene transcriptions}}
+{{main|Downstream TFIIB recognition element gene transcriptions}}
-"The GCC box, also referred to as the '''AGC box''' (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."<ref name=Buttner>{{ cite journal
+The downstream B recognition element [(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)] designated as the BRE<sup>d</sup>,<ref name=Deng/> or dBRE, is an additional core promoter element that occurs downstream of the [[TATA box]] and is recognized by general transcription factor II B.<ref name=Deng>{{ cite journal
-|author=Michael Büttner and Karam B. Singh
+|author=Wensheng Deng, Stefan G.E. Roberts
-|title=''Arabidopsis thaliana'' ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein
+|title=A core promoter element downstream of the TATA box that is recognized by TFIIB
-|journal=Proceedings of the National Academy of Sciences of the United States of America
+|journal=Genes & Development
-|date=May 27, 1997
+|date=October 15, 2005
-|volume=94
+|volume=19
-|issue=11
+|issue=20
-|pages=5961-6
+|pages=2418–23
-|url=http://www.pnas.org/content/94/11/5961.long
+|url=http://genesdev.cshlp.org/content/19/20/2418.full
+|doi=10.1101/gad.342405
+|pmid=16230532 }}</ref>
+==Downstream core elements==
+{{main|Downstream core element gene transcriptions}}
+A core promoter that contains all three subelements of the downstream core element [DCE] may be much less common than one containing only one or two.<ref name=Lee/> "S<sub>I</sub> resides approximately from +6 to +11, S<sub>II</sub> from +16 to +21, and S<sub>III</sub> from +30 to +34."<ref name=Lee>{{ cite journal
+|author=Dong-Hoon Lee, Naum Gershenzon, Malavika Gupta, Ilya P. Ioshikhes, Danny Reinberg and Brian A. Lewis
+|title=Functional Characterization of Core Promoter Elements: the Downstream Core Element Is Recognized by TAF1
+|journal=Molecular and Cellular Biology
+|date=November 2005
+|volume=25
+|issue=21
+|pages=9674-86
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1265815/
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1128/MCB.25.21.9674-9686.2005
-|pmid=
+|pmid=16227614
-|accessdate=2014-05-02 }}</ref>
+|accessdate=2010-10-23 }}</ref>
-===AGC box distal promoters===
+The consensus sequence for the DCE is CTTC...CTGT...AGC.<ref name=Lee/> These three consensus elements are referred to as subelements: "S<sub>I</sub> is CTTC, S<sub>II</sub> is CTGT, and S<sub>III</sub> is AGC."<ref name=Lee/>
-Negative strand, negative direction: 5'-CCGCCGA-3' at 1754 nts and complement.
+==Downstream promoter elements==
+{{main|Downstream promoter element gene transcriptions}}
+The early DPE consensus sequence was RGWCGTG.<ref name=Burke1996>{{ cite journal
+| author = T.W. Burke and James T. Kadonaga
+| date = 15 March 1996
+| title = Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters
+| journal = Genes & Development
+| volume = 10
+| issue = 6
+| pages = 711–724
+| doi = 10.1101/gad.10.6.711
+| pmid = 8598298
+| url = http://genesdev.cshlp.org/content/10/6/711.full.pdf }}</ref><ref name=Kadonaga2002>{{ cite journal
+| author = James T. Kadonaga
+| date = September 2002
+| title = The DPE, a core promoter element for transcription by RNA polymerase II
+| journal = Experimental & Molecular Medicine
+| volume = 34
+| issue = 4
+| pages = 259–264
+| doi =
+| pmid = 12515390
+| url = http://www.e-emm.or.kr/article/article_files/emm34-4-1.pdf }}</ref>
-==Androgen response elements==
+The DPE consensus sequence is the more general sequence RGWYVT, or (A/G)G(A/T)(C/T)(A/C/G)T.<ref name=Juven-Gershon2010>{{ cite journal
-{{main|Androgen response element gene transcriptions}}
+| author = Tamar Juven-Gershon, James T. Kadonaga
+| date = March 15, 2010
+| title = Regulation of Gene Expression via the Core Promoter and the Basal Transcriptional Machinery
+| journal = Developmental Biology
+| volume = 339
+| issue = 2
+| pages = 225–9
+| doi = 10.1016/j.ydbio.2009.08.009
+| pmid = 19682982
+| pmc = 2830304 }}</ref>
-===Androgen response element (Kouhpayeh) proximal promoters===
+The DPE in "the ATP‐binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''" is 5'-AGTCTC-3'.<ref name=Matsumoto/>
-Negative strand, positive direction: 5'-AGAACA-3' at 4068, and complement.
+==E2 boxes==
+{{main|E2 box gene transcriptions}}
-===Androgen response element (Kouhpayeh) distal promoters===
+"The most dramatic impact on immunoglobulin gene enhancer activity was observed upon mutation of sites that contain an E2-box motif (G/ACAGNTGN)."<ref name=Murre>{{ cite journal
+|author=Cornelis Murre and David Baltimore
-Negative strand, negative direction: 5'-TGTTCT-3' at 3759, 5'-TGTTCT-3' at 3635, 5'-TGTTCT-3' at 3340, 5'-TGTTCT-3' at 3307, TGTACC-3' at 2614, 5'-TGTACC-3' at 2152, 5'-TGTACC-3' at 1207, 5'-ACATGG-3' at 798, 5'-AGAACA-3' at 281 and complements.
+|title=The Helix-Loop-Helix Motif: Structure and Function, In: ''Transcriptional Regulation''
+|publisher=Cold Spring Harbor Laboratory Press
+|location=
+|date=1992
+|volume=22B
+|editor=
+|pages=861-79
+|url=https://cshmonographs.org/csh/index.php/monographs/article/viewPDFInterstitial/3449/2723
+|arxiv=
+|bibcode=
+|doi=10.1101/087969425.22B.861
+|pmid=
+|isbn=
+|accessdate=2017-02-08 }}</ref>
-Positive strand, negative direction: 5'-AGAACA-3' at 3668, 5'-AGAACA-3' at 287, 5'-TGTTCT-3' at 45 and complement.
+==EIN3 binding sites==
+{{main|EIN3 binding site gene transcriptions}}
+"We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gene [...]."<ref name=Qiu>{{ cite journal
+|author=Kai Qiu, Zhongpeng Li, Zhen Yang, Junyi Chen, Shouxin Wu, Xiaoyu Zhu, Shan Gao, Jiong Gao, Guodong Ren, Benke Kuai, and Xin Zhou
+|title=EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in ''Arabidopsis''
+|journal=PLoS Genetics
+|date=July 2015
+|volume=11
+|issue=7
+|pages=e1005399
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4517869/
+|arxiv=
+|bibcode=
+|doi=10.1371/journal.pgen.1005399
+|pmid=26218222
+|accessdate=4 October 2020 }}</ref>
-Negative strand, positive direction: 5'-AGAACA-3' at 3094, 5'-TGTTCT-3' at 108 and complements.
+"EIN3/EIL1 transcription factors were reported to bind to a consensus DNA sequence of A[CT]G[AT]A[CT]CT [34,35]."<ref name=Qiu/>
-Positive strand, positive direction: 5'-GGTACA-3' at 3901, 5'-GGTACA-3' at 3336, 5'-GGTACA-3' at 2474, 5'-TGTACC-3' at 2032, 5'-ACAAGA-3' at 108 and complements.
+==Endoplasmic reticulum stress response elements==
+{{main|Endoplasmic reticulum stress response element gene transcriptions}}
+"The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response element (ERSE) containing the consensus sequence CCAAT-N9-CCACG to activate genes encoding ER chaperones, ERAD components, and XBP1 (Chen et al., 2010; Yamamoto et al., 2004; Yoshida et al., 2001)."<ref name=So>{{ cite journal
+|author=Jae-Seon So
+|title=Roles of Endoplasmic Reticulum Stress in Immune Responses
+|journal=Molecules and Cells
+|date=31 August 2018
+|volume=41
+|issue=8
+|pages=705-16
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6125421/
+|arxiv=
+|bibcode=
+|doi=10.14348/molcells.2018.0241
+|pmid=30078231
+|accessdate=5 September 2020 }}</ref>
-===Androgen response element (Wilson) proximal promoters===
+==Endosperm expression==
+{{main|Endosperm expression gene transcriptions}}
+Endosperm expression (TGTGTCA).<ref name=Sharma/>
-Negative strand, positive direction: 5'-AGAACA-3' at 4068, and complement.
+==Enhancer boxes==
+{{main|Enhancer box gene transcriptions}}
-===Androgen response element (Wilson) distal promoters===
+The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence of CACGTG.<ref name=Chaudhary>{{ cite journal
+|author=Jaideep Chaudhary and Michael K. Skinner
+|title=Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells
+|journal=Molecular Endocrinology
+|date=May 1999
+|volume=13
+|issue=5
+|pages=774-86
+|url=http://mend.endojournals.org/content/13/5/774.short
+|arxiv=
+|bibcode=
+|doi=10.1210/me.13.5.774
+|pmid=10319327
+|accessdate=2013-06-14 }}</ref>
-Negative strand, negative direction: 5'-AGAACA-3' at 281 and complement.
+==Ethylene responsive elements==
+{{main|Ethylene responsive element gene transcriptions}}
+Ethylene responsive elements (ATTTCAAA).<ref name=Sharma/>
-Positive strand, negative direction: 5'-AGAACA-3' at 3668, 5'-AGAACA-3' at 287 and complements.
+==Forkhead boxes==
+{{main|Forkhead box gene transcriptions}}
+"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)<sup>11–13</sup>."<ref name=Li2017/>
-Negative strand, positive direction: 5'-AGAACA-3' at 3094 and complement.
+==GAAC elements==
+{{main|GAAC element gene transcriptions}}
+"[A] short sequence [in TSE1 contains] a GAACT motif that [binds] a tendon-specific nuclear protein."<ref name=Terraz>{{ cite journal
+|author=Catherine Terraz, Gaelle Brideau, Pierre Ronco and Jérôme Rossert
+|title=A Combination of ''cis''-Acting Elements Is Required to Activate the Pro-α1(I) Collagen Promoter in Tendon Fibroblasts of Transgenic Mice
+|journal=The Journal of Biological Chemistry
+|date=May 24, 2002
+|volume=277
+|issue=21
+|pages=19019-26
+|url=http://www.jbc.org/content/277/21/19019.long
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.M200125200
+|pmid=
+|accessdate=2013-02-13 }}</ref>
-Positive strand, positive direction: 5'-ACAAGA-3' at 108 and complement.
+==GA responsive elements==
+{{main|GARE gene transcriptions}}
+"Although this GARC [GA responsive complex] may not always be tripartite, most often it includes three sequence motifs, the TAACAAA box or GA responsive element (GARE), the pyrimidine box CCTTTT, and the TATCCAC box (Skriver et al., 1991;Gubler and Jacobsen, 1992; Rogers et al., 1994)."<ref name=Mena>{{ cite journal
+|author=Montaña Mena, Francisco Javier Cejudo, Ines Isabel-Lamoneda and Pilar Carbonero
+|title=A Role for the DOF Transcription Factor BPBF in the Regulation of Gibberellin-Responsive Genes in Barley Aleurone
+|journal=Plant Physiology
+|date=1 September 2002
+|volume=130
+|issue=1
+|pages=111-9
+|url=http://www.plantphysiol.org/content/130/1/111.full
+|arxiv=
+|bibcode=
+|doi=10.1104/pp.005561
+|pmid=
+|accessdate=2017-02-19 }}</ref>
-Negative strand, negative direction: 5'-TGTTCT-3' at 3759, 5'-TGTTCT-3' at 3635, 5'-TGTTCT-3' at 3340, 5'-TGTTCT-3' at 3307, and complements.
+Several GA-responsive cis-acting elements (GARE) and GARE-like elements (TAACAA/GA, or TAACGTA) have been identified in the promoters of hydrolase genes expressed in the aleurone (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003; Washio 2003), expansin genes expressed in internodes (Lee et al. 2001), and many GAMYB-regulated genes expressed in anthers (Tsuji et al. 2006)."<ref name=Fan>{{ cite journal
+|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
+|title=Gibberellin Signal Transduction in Rice
+|journal=Journal of Integrative Plant Biology
+|date=2007
+|volume=49
+|issue=6
+|pages=731−741
+|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
+|arxiv=
+|bibcode=
+|doi=10.1111/j.1744-7909.2007.00511.x
+|pmid=
+|accessdate=16 October 2018 }}</ref>
-Positive strand, negative direction: 5'-TGTTCT-3' at 45 and complement.
+==GATA boxes==
+{{main|GATA gene transcriptions}}
+GTGA-box has the consensus sequence GATA.<ref name=Ye/>
-Negative strand, positive direction: 5'-TGTTCT-3' at 108 and complements.
+==GC boxes==
+{{main|GC box gene transcriptions}}
-==Angiotensinogen core promoter elements==
+"A GC box sequence, one of the most common regulatory DNA elements of eukaryotic genes, is recognized by the Spl transcription factor; its consensus sequence is represented as 5'-G/T G/A GGCG G/T G/A G/A C/T-3' [or 5′-KRGGCGKRRY-3′] (Briggs et al., 1986)."<ref name=Imataka>{{ cite journal
-{{main|Angiotensinogen core promoter element gene transcriptions}}
+|author=H Imataka, K Sogawa, KI Yasumoto, Y Kikuchi, K Sasano, A Kobayashi, M Hayami, and Y Fujii-Kuriyama
-The consensus sequence is 5'-A/C-T-C/T-3'.<ref name=NSato>{{ cite journal
+|title=Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene
-|author=Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara
+|journal=The EMBO Journal
-|title=Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese
+|date=October 1992
-|journal=Hypertension
+|volume=11
-|date=September 1997
+|issue=10
-|volume=30
+|pages=3663-71
-|issue=3 Pt 1
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556826/pdf/emboj00095-0180.pdf
-|pages=321-5
-|url=http://www.ncbi.nlm.nih.gov/pubmed/9314411
 |arxiv=
 |bibcode=
-|doi=10.1161/01.HYP.30.3.321
+|doi=
-|pmid=9314411
+|pmid=1356762
-|accessdate=2012-02-20 }}</ref> The core nucleotides for AGCE1 include 5'-A/C-T-C/T-G-T-G-3', "located between the TATA box and [[Transcription start site|transcription initiation site]] (positions −25 to −1) is an authentic regulator of human AG transcription."<ref name=Yanai>{{ cite journal
+|accessdate=2013-01-27 }}</ref>
-|author=Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu
-|title=Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity
+==GCC elements==
+{{main|AGC box gene transcriptions}}
+"The GCC box, also referred to as the '''AGC box''' (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."<ref name=Buttner/>
+==Gcn4ps==
+{{main|Gcn4p gene transcriptions}}
+"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."<ref name=Staschke>{{ cite journal
+|author=Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek
+|title=Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen Assimilation in Yeast
 |journal=The Journal of Biological Chemistry
-|date=28 November 1997
+|date=May 28, 2010
-|volume=272
+|volume=285
-|issue=48
+|issue=22
-|pages=30558-62
+|pages=16893–16911
-|url=http://www.jbc.org/cgi/pmidlookup?view=long&pmid=9374551
+|url=https://www.jbc.org/content/285/22/16893.full.pdf
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1074/jbc.M110.121947
-|pmid=9374551
+|pmid=
-|accessdate=2012-02-20 }}</ref>
+|accessdate=4 January 2021 }}</ref>
-===AGCE core promoters===
-{{main|Core promoter gene transcriptions}}
-Negative direction: 5'-CACGAG-3' at 4472 and complement.
-Positive direction: 5'-CTCGTG-3' at 4376 and complement.
-===AGCE proximal promoters===
-{{main|Proximal promoter gene transcriptions}}
-Negative direction: 5'-CACGAG-3' at 4403 and complement.
-===AGCE distal promoters===
+"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -􏰉206 and -􏰉112, respectively, [...]."<ref name=Staschke/>
-{{main|Distal promoter gene transcriptions}}
-Negative direction: 5'-CTCGTG-3' at 3914, 5'-CTTGTG-3' at 3669, 5'-CACAAG-3' at 3634, 5'-CACAAT-3' at 3515, 5'-CACGAG-3' at 3232, 5'-CACAAG-3' at 2244, 5'-ATCGTG-3' at 2096, 5'-CACAAT-3' at 1721, 5'-CACGAG-3' at 1182, 5'-CACGAG-3' at 708, 5'-CACGAG-3' at 572, 5'-CACGAG-3' at 435, 5'-ATTGTG-3' at 340, 5'-CACGAT-3' at 336 and complements.
-Positive direction: 5'-CTCGTG-3' at 3739, 5'-CACGAG-3' at 3152, 5'-CTTGTG-3' at 3095, 5'-ATTGTG-3' at 2679, 5'-CACGAG-3' at 2090, 5'-CTCGTG-3' at 1627, 5'-CTCGTG-3' at 1207, 5'-CTCGTG-3' at 955, 5'-CTCGTG-3' at 855, 5'-CACGAG-3' at 243, 5'-CACAAG-3' at 107 and complements.
+==GGC triplets==
+{{main|GGC triplet gene transcriptions}}
-==Antioxidant-electrophile responsive elements==
+"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly related sequences rich in GGC triplets [15]."<ref name=Ruiz>{{ cite journal
+|author=Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti and Susana Correa-Garcia
-'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3' is the consensus sequence of a functional antioxidant response element at the HIF1A locus.<ref name=Lacher>{{ cite journal
+|title=Unravelling the transcriptional regulation of ''Saccharomyces cerevisiae UGA'' genes: the dual role of transcription factor Leu3
-|author=Sarah E. Lacher, Daniel C. Levings, Samuel Freeman, Matthew Slattery
+|journal=Microbiology
-|title=Identification of a functional antioxidant response element at the HIF1A locus
+|date=12 October 2017
-|journal=Redox Biology
+|volume=163
-|date=October 2018
-|volume=19
 |issue=
-|pages=401-411
+|pages=1692-1701
-|url=https://www.sciencedirect.com/science/article/pii/S2213231718305391
+|url=https://www.researchgate.net/profile/Mariana-Bermudez-2/publication/320571623_Unravelling_the_transcriptional_regulation_of_Saccharomyces_cerevisiae_UGA_genes_the_dual_role_of_transcription_factor_Leu3/links/5c62114c299bf1d14cbf7ade/Unravelling-the-transcriptional-regulation-of-Saccharomyces-cerevisiae-UGA-genes-the-dual-role-of-transcription-factor-Leu3.pdf
 |arxiv=
 |bibcode=
-|doi=10.1016/j.redox.2018.08.014
+|doi=10.1099/mic.0.000560
 |pmid=
-|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE).
+|accessdate=20 April 2021 }}</ref>
-===AERE (Lacher) distal promoters===
+"MEME analysis identified phylogenetically conserved CCGN<sub>4</sub>CGG motifs in promoters of several [branched-chain amino acid] BCAA biosynthetic genes"<ref name=Long2018>{{ cite journal
+|author=Nanbiao Long, Thomas Orasch, Shizhu Zhang, Lu Gao, Xiaoling Xu, Peter Hortschansky, Jing Ye, Fenli Zhang, Kai Xu, Fabio Gsaller, Maria Straßburger, Ulrike Binder, Thorsten Heinekamp, Axel A. Brakhage, Hubertus Haas, Ling Lu
+|title=The Zn<sub>2</sub>Cys<sub>6</sub>-type transcription factor LeuB cross-links regulation of leucine biosynthesis and iron acquisition in ''Aspergillus fumigatus''
+|journal=PLOS Genetics
+|date=26 October 2018
+|volume=14
+|issue=10
+|pages=e1007762
+|url=https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007762
+|arxiv=
+|bibcode=
+|doi=10.1371/journal.pgen.1007762
+|pmid=
+|accessdate=20 April 2021 }}</ref>
-Negative strand, negative direction: 5'-TGACTATGC-3' at 3546, 5'-TTAATCGGC-3' at 1237, and complements.
+==Gibberellin responsive elements==
+{{main|Gibberellin responsive element gene transcriptions}}
+Gibberellin responsive elements (CCTTTTG, AAACAGA).<ref name=Sharma/>
-Positive strand, negative direction: 5'-TGAGTTGGC-3' at 4098, 5'-TTAAAAGGC-3' at 3442, 5'-GCAGTGTAA-3' at 2087, 5'-TTAGCCAGC-3' at 504, 5'-GCATTTTAA-3' at 192 and complements.
+==Γ-interferon activated sequences==
+{{main|Γ-interferon activated sequence gene transcriptions}}
+"Computer analysis of the nt −653 to nt −483 region identified two sites that resemble the [γ-interferon activated sequence] GAS consensus sequence, TTNCNNNAA (19). Similar GAS-like sites have been shown to mediate the effects of various cytokines, including [growth hormone] GH, on the transcription of other genes (19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt −633 and nt −625; the second site, TTAGACAAA (ALS-GAS2), is located between nt −553 and nt −545."<ref name=Ooi>{{ cite journal
+|author=Guck T. Ooi, Kelley R. Hurst, Matthew N. Poy, Matthew M. Rechler, Yves R. Boisclair
+|title=Binding of STAT5a and STAT5b to a Single Element Resembling a γ-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells
+|journal=Molecular Endocrinology
+|date=1 May 1998
+|volume=12
+|issue=5
+|pages=675-687
+|url=https://academic.oup.com/mend/article/12/5/675/2754376
+|arxiv=
+|bibcode=
+|doi=10.1210/mend.12.5.0115
+|pmid=9605930
+|accessdate=9 September 2020 }}</ref>
-Negative strand, positive direction: 5'-TGACCAGGC-3' at 2877 and complement.
+==Glucocorticoid response elements==
+{{main|Glucocorticoid response element gene transcriptions}}
-Positive strand, positive direction: 5'-TGAAAAAGC-3' at 1750 and complement.
+"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."<ref name=Parsonnet>{{ cite journal
+|author=Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke
-==ATA boxes==
+|title=The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity
-{{main|ATA box gene transcriptions}}
+|journal=Nucleic Acids Research
-"The 3' flanking area contained the highly conserved hexanucleotide sequence A-A-T-A-A-A found in eukaryotic messages between the terminator codon and the polyadenylylation site (44)."<ref name=Liebhaber>{{ cite journal
+|date=5 September 2019
-|author=Stephen A. Liebhaber, Michel J. Goossens, and Yuet Wai Kan
+|volume=47
-|title=Cloning and complete nucleotide sequence of human 5'-α-globin gene
+|issue=15
-|journal=Proceedings of the National Academy of Science USA
+|pages=8180-8192
-|date=December 1980
+|url=https://academic.oup.com/nar/article/47/15/8180/5506867
-|volume=77
-|issue=12
-|pages=7054-8
-|url=http://www.pnas.org/content/77/12/7054.full.pdf
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1093/nar/gkz486
-|pmid=
+|pmid=31147715
-|accessdate=2013-06-28 }}</ref>
+|accessdate=28 August 2020 }}</ref>
-===ATA core promoters===
+==Gcr1ps==
-{{main|Core promoter gene transcriptions}}
+{{main|Gcr1p gene transcriptions}}
-Negative direction: 5'-AAATAA-3' at 4537 and complement.
+The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in the regulation of glycolysis [77].<ref name=Tang/>
+==GT boxes==
+{{main|TC element gene transcriptions}}
+"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."<ref name=Sato1993>{{ cite journal
+|author=Hiroshi Sato, Megumi Kita, and Motoharu Seiki
+|title=v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements
+|journal=The Journal of Biological Chemistry
+|date=5 November 1993
+|volume=268
+|issue=31
+|pages=23460-8
+|url=https://www.jbc.org/content/268/31/23460.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=8226872
+|accessdate=13 August 2020 }}</ref>
-===ATA proximal promoters===
+==Hac1s==
-{{main|Proximal promoter gene transcriptions}}
+{{main|Hac1p gene transcriptions}}
-Negative direction: 5'-AAATAA-3' at 4221 and complement.
+"The similar UPRE-1 is also found in the promoter region of the ''P. pastoris'' ''KAR2'' (CAGCGTG), ''INO1'' (CAACTTG) and ''HAC1'' (CAACTTG) genes [15]. The presence of an ''HAC1'' UPRE implies that Hac1p can up-regulate its own transcription. Unconventional splicing of ''HAC1'' mRNA after ER stress signaling generates the active form of basic leucine zipper (bZIP) transcription factor Hac1p, which binds to the UPRE [16]."<ref name=Kullawong>{{ cite journal
+|author=Niwed Kullawong, Sutipa Tanapongpipat, Lily Eurwilaichitr and Witoon Tirasophon
+|title=Unfolded Protein Response (UPR) Induced Hybrid Promoters for Heterologous Gene Expression in ''Pichia pastoris''
+|journal=Chiang Mai Journal of Science
+|date=2018
+|volume=45
+|issue=7
+|pages=2554-2565
+|url=http://www.thaiscience.info/Journals/Article/CMJS/10990408.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|accessdate=11 January 2021 }}</ref>
-===ATA distal promoters===
+==H boxes==
-{{main|Distal promoter gene transcriptions}}
+{{main|H box gene transcriptions}}
-Negative direction: 5'-AAATAA-3' at 4075, 5'-AATAAA-3' at 4072, 5'-AAATAA-3' at 4071, 5'-AATAAA-3' at 3335, 5'-AAATAA-3' at 3334, 5'-AATAAA-3' at 3014, 5'-AAATAA-3' at 3013, 5'-AATAAA-3' at 1726 and complements.
+"The box H/ACA snoRNAs [...] have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity."<ref name=Mitchell/>
+The "3' end of mature [human telomerase] hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."<ref name=Mitchell/>
-Positive direction: 5'-AAATAA-3' at 703 and complement.
+"Comparison with the murine telomerase RNA (mTR) (7) suggests that the snoRNA-like features of hTR are evolutionarily conserved. The mTR 3' end [...] includes consensus H (5'-ACAGGA-3') and ACA box sequences."<ref name=Mitchell/>
-==B boxes==
+An H box has a consensus sequence of 3'-ACACCA-5'.<ref name=Rozhdestvensky>{{ cite journal
-{{main|B box gene transcriptions}}
+|author=Timofey S. Rozhdestvensky, Thean Hock Tang, Inna V. Tchirkova, Jürgen Brosius, Jean‐Pierre Bachellerie and Alexander Hüttenhofer
-While there appear to be at least two B boxes, TGGGCA is one B-box,<ref name=Johnson>{{ cite journal
+|title=Binding of L7Ae protein to the K‐turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea
-|author=PA Johnson, D Bunick, NB Hecht
+|journal=Nucleic Acids Research
-|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
+|date=2003
-|journal=Biology of Reproduction
+|volume=31
-|date=1991
+|issue=3
-|volume=44
+|pages=869-77
-|issue=1
+|url=http://nar.oxfordjournals.org/content/31/3/869.long
-|pages=127-134
-|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
 |arxiv=
 |bibcode=
-|doi=10.1095/biolreprod44.1.127
+|doi=10.1093/nar/gkg175
-|pmid=2015343
+|pmid=
-|accessdate=6 April 2019 }}</ref> where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the ''Dde'' I site at position -140 to the ''Dde'' I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."<ref name=Johnson/>
+|accessdate=2014-06-08 }}</ref>
-===B box proximal promoters===
+"In humans, telomerase is composed of a reverse transcriptase (hTERT), which uses the RNA component (hTERC) to dock onto the 3′ single-stranded telomere end. hTERT may then processively synthesise telomeric repeats from the template provided by hTERC, before dissociating<sup>7–9</sup>. All telomerase RNAs possess a 3′ end element necessary for its stability<sup>10</sup>. In hTERC, this is two stem-loop structures separated by an H-box (ANANNA) and ACA motif (H/ACA). The binding of telomerase factors dyskerin, NOP10, and NHP2 at the H/ACA motif form the so-called ‘pre-ribonucleoprotein complex’, before GAR1 binds in transition to the mature RNP<sup>11,12</sup>. hTERC then binds to chaperone TCAB1, which assists its trafficking to the Cajal bodies where the functional telomerase complex localises<sup>13</sup>. Recruitment to the telomeres in S-phase is mediated by the protective complex shelterin<sup>14,15</sup>. Correct assembly of the telomerase complex, with appropriate co-factors for maturation, stability, and subcellular localisation, is necessary for its function and thus telomere maintenance."<ref name=Collopy>{{ cite journal
+|author=Laura C. Collopy, Tracy L. Ware, Tomas Goncalves, Sunnvør í Kongsstovu, Qian Yang, Hanna Amelina, Corinne Pinder, Ala Alenazi, Vera Moiseeva, Siân R. Pearson, Christine A. Armstrong & Kazunori Tomita
+|title=LARP7 family proteins have conserved function in telomerase assembly
+|journal=Nature Communications
+|date=2018
+|volume=9
+|issue=557
+|pages=1-8
+|url=https://www.nature.com/articles/s41467-017-02296-4.pdf?origin=ppub
+|arxiv=
+|bibcode=
+|doi=10.1038/s41467-017-02296-4
+|pmid=
+|accessdate=1 August 2019 }}</ref>
-Negative direction: 5'-TGCCCA-3' at 4251 and complement.
+"The KAP-2 protein [...] binds to the H-box (CCTACC) element in the bean CHS15 chalcone synthase promoter".<ref name=Lindsay>{{ cite journal
+|author=William P. Lindsay, Fiona M. McAlister, Qun Zhu, Xian-Zhi He, Wolfgang Dröge-Laser, Susie Hedrick, Peter Doerner, Chris Lamb and Richard A. Dixon
+|title=KAP-2, a protein that binds to the H-box in a bean chalcone synthase promoter, is a novel plant transcription factor with sequence identity to the large subunit of human Ku autoantigen
+|journal=Plant Molecular Biology
+|date=July 2002
+|volume=49
+|issue=5
+|pages=503–514
+|url=https://link.springer.com/article/10.1023/A:1015505316379
+|arxiv=
+|bibcode=
+|doi=10.1023/A:1015505316379
+|pmid=
+|accessdate=5 October 2019 }}</ref>
-Positive direction: 5'-TGGGCA-3' at 4180 and complement.
+"Two distinct sequence elements, the H-box (consensus CCTACC(N)<sub>7</sub>CT) and the G-box (CACGTG), are required for stimulation of the ''chs15'' promoter by 4-CA."<ref name=Loake>{{ cite journal
+|author=Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon
+|title=Combination of H-box [CCTACC(N)<sub>7</sub>CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate ''p''-coumaricacid
+|journal=Proceedings of the National Academy of Sciences USA
+|date=October 1992
+|volume=89
+|issue=19
+|pages=9230-9234
+|url=https://www.pnas.org/content/pnas/89/19/9230.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.89.19.9230
+|pmid=
+|accessdate=16 March 2021 }}</ref>
-===B box distal promoters===
+==Heat shock elements==
+{{main|Hsf1p gene transcriptions}}
-Negative direction: 5'-TGGGCA-3' at 4191, 5'-TGGGCA-3' at 4040, 5'-TGCCCA-3' at 3883, 5'-TGCCCA-3' at 3854, 5'-TGGGCA-3' at 3301, 5'-TGGGCA-3' at 2773, 5'-TGGGCA-3' at 2438, 5'-TGCCCA-3' at 1458, 5'-TGGGCA-3' at 1359, 5'-TGGGCA-3' at 1114, 5'-TGGGCA-3' at 902, 5'-TGGGCA-3' at 462, and complements.
+"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In ''Saccharomyces cerevisiae'', this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."<ref name=Eastmond>{{ cite journal
+|author=Dawn L. Eastmond and Hillary C. M. Nelson
-Positive direction: 5'-TGCCCA-3' at 3750, 5'-TGCCCA-3' at 3377, 5'-TGCCCA-3' at 3237, 5'-TGGGCA-3' at 2894, 5'-TGGGCA-3' at 1945, 5'-TGGGCA-3' at 27 and complements.
+|title=Genome-wide Analysis Reveals New Roles for the Activation Domains of the ''Saccharomyces cerevisiae'' Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response
+|journal=Journal of Biological Chemistry
-The other is associated with the human transforming growth factor b1 binding sequences.<ref name=Paratore>{{ cite journal
+|date=October 27, 2006
-|author=Amber Paratore Sanchez and Kumar Sharma
+|volume=281
-|title=Transcription factors in the pathogenesis of diabetic nephropathy
+|issue=43
-|journal=Expert Reviews in Molecular Medicine
+|pages=P32909-32921
-|date=July 2009
+|url=https://www.jbc.org/article/S0021-9258(20)86866-5/fulltext
-|volume=11
-|issue=
-|pages=e13
-|url=https://www.cambridge.org/core/journals/expert-reviews-in-molecular-medicine/article/transcription-factors-in-the-pathogenesis-of-diabetic-nephropathy/5459130CB955272C047982BE21FEE256
 |arxiv=
 |bibcode=
-|doi=10.1017/S1462399409001057
+|doi=10.1074/jbc.M602454200
-|pmid=19397838
+|pmid=
-|accessdate=1 October 2018 }}</ref>
+|accessdate=19 January 2021 }}</ref>
-And, has the consensus sequence 5'-TGTCTCA-3'. Let it be designated B1box.
+"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."<ref name=Eastmond/>
-===B1 box proximal promoters===
+==Hex sequences==
-{{main|Proximal promoter gene transcriptions}}
+{{main|Hex sequence gene transcriptions}}
-Negative direction: 5'-TGTCTCA-3' at 4373 and complement.
+The Hex sequence has the consensus (TGACGTGGC).<ref name=Song/>
-===B1 box distal promoters===
+==HMG boxes==
-{{main|Distal promoter gene transcriptions}}
+{{main|HMG box gene transcriptions}}
-Negative direction: 5'-TGTCTCA-3' at 3323, 5'-TGTCTCA-3' at 2445, 5'-TGTCTCA-3' at 2033, 5'-TGAGACA-3' at 2029, 5'-TGTCTCA-3' at 1089, 5'-TGAGACA-3' at 1085, 5'-TGTCTCA-3' at 1075, 5'-TGTCTCA-3' at 923, 5'-TGAGACA-3' at 919 and complements.
+"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."<ref name=Laudet>{{ cite journal
+|author=Vincent Laudet, Dominique Stehelin and Hans Clevers
-Positive direction: 5'-TGTCTCA-3' at 2468, 5'-TGAGACA-3' at 2308, 5'-TGTCTCA-3' at 2174 and complements.
+|title=Ancestry and diversity of the HMG box superfamily
+|journal=Nucleic Acids Research
-==B recognition elements==
+|date=1993
-{{main|Factor II B recognition element gene transcriptions}}
+|volume=21
-The factor II B recognition element is BRE<sup>u</sup>.
+|issue=10
+|pages=2493-501
-"The transcription factor II B recognition elements BRE<sup>u</sup> "CGACGCA" and BRE<sup>d</sup> "ATGGTTG" were upstream (− 279 to − 273 of the transcript) and downstream (− 165 to − 159 of the transcript) of the TATA box, respectively."<ref name=Matsumoto>{{ cite journal
+|url=https://academic.oup.com/nar/article-pdf/21/10/2493/4086740/21-10-2493.pdf
-|author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima
-|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
-|journal=Fisheries Science
-|date=9 August 2020
-|volume=86
-|issue=
-|pages=873-887
-|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
 |arxiv=
 |bibcode=
-|doi=10.1007/s12562-020-01451-z
+|doi=10.1093/nar/21.10.2493
-|pmid=
+|pmid=8506143
-|accessdate=27 September 2020 }}</ref>
+|accessdate=2017-04-05 }}</ref>
-The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.<ref name=Yang>{{ cite journal
+==HNFs==
-|author=Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez.
+{{main|HNF gene transcriptions}}
-|title=Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters
+Gene ID: 6927 is [[HNF1A]] HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."<ref name=RefSeq6927>{{ cite book
-|journal=Gene
+|vauthors=RefSeq
-|date=March 7, 2007
+|title=HNF1A HNF1 homeobox A [ Homo sapiens (human) ]
-|volume=389
+|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|issue=1
+|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|pages=52-65
+|date=April 2015
-|pmid=17123746
+|url=https://www.ncbi.nlm.nih.gov/gene/6927
-|doi=10.1016/j.gene.2006.09.029
+|accessdate=7 November 2018 }}</ref>
-|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1955227/?tool=pubmed }}</ref>
-The consensus sequence is 5’-G/C G/C G/A C G C C-3’.<ref name=Kutach>{{ cite journal
+"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1."<ref name=Li2020/> TCF-1 binding site is CCTTTGA.<ref name=Li2020>{{ cite journal
-|author=Alan K. Kutach, James T. Kadonaga
+|author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
-|title=The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in ''Drosophila'' Core Promoters
+|title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
-|journal=Molecular and Cellular Biology
+|journal=Oncogene
-|date=July 2000
+|date=July 2020
-|volume=20
+|volume=39
-|issue=13
+|issue=29
-|pages=4754-64
+|pages=5187-5200
-|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC85905/pdf/mb004754.pdf
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7398576/
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1038/s41388-020-1344-y
-|pmid=10848601
+|pmid=32555331
-|accessdate=2012-07-15 }}</ref>
+|accessdate=29 August 2020 }}</ref>
-===BRE<sup>u</sup> distal promoters===
+"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."<ref name="Gardmo">{{cite journal
+|author=Cissi Gardmo and Agneta Mode
-Negative strand, negative direction: 5'-CCACGCC-3' at 2197, 5'-CCGCGCC-3' at 1762, 5'-CCTGCGG-3' at 1153, 5'-CCACGCC-3' at 380, and complements.
+|date=1 December 2006
+|title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression
-Positive strand, negative direction: 5'-GGCGTGG-3' at 3047, 5'-GGCGTGG-3' at 1897, 5'-GGCGTGG-3' at 1244, and complements.
+|url=http://jme.endocrinology-journals.org/content/37/3/433.full
+|journal=Journal of Molecular Endocrinology
-Negative strand, positive direction: 5'-GGCGCCC-3' at 1770, 5'-GGGCGCC-3' at 1769, 5'-GGACGCC-3' at 1672, 5'-GCACGCC-3' at 1302 and complements.
+|volume=37
+|issue=3
-Positive strand, positive direction: 5'-GGCGTGG-3' at 2566, 5'-CCACGCC-3' at 1764, 5'-GGCGCCG-3' at 1438, 5'-GGCGCCG-3' at 1338, 5'-CGACGCC-3' at 1033, 5'-GGCGCGC-3' at 682, 5'-CCACGCC-3' at 489, and complements.
+|pages=433-441
-==CadC binding domains==
-{{main|CadC binding domain gene transcriptions}}
-"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."<ref name=Schlundt>{{ cite journal
-|author=Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler
-|title=Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator
-|journal=Scientific Reports
-|date=21 April 2017
-|volume=7
-|issue=
-|pages=1051
-|url=https://www.nature.com/articles/s41598-017-01031-9/briefing/signup/
 |arxiv=
 |bibcode=
-|doi=10.1038/s41598-017-01031-9
+|doi=10.1677/jme.1.02116
-|pmid=28432336
+|pmid=17170084
-|accessdate=28 August 2020 }}</ref> "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites."<ref name=Schlundt/> "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."<ref name=Schlundt/>
+|accessdate=2017-09-01 }}</ref>
-===CadC core promoters===
+==Homeoboxes==
+{{main|Homeobox gene transcriptions}}
+"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."<ref name=Kalousova>{{ cite journal
+|author=Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik
+|title=DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4
+|journal=Biochemical and Biophysical Research Communications
+|date=June 1999
+|volume=259
+|issue=3
+|pages=510-518
+|url=https://www.sciencedirect.com/science/article/abs/pii/S0006291X99908094
+|arxiv=
+|bibcode=
+|doi=
+|pmid=10364449
+|accessdate=6 May 2020 }}</ref>
-Negative strand, negative direction: 5'-ATAATTAA-3' at 4541, 5'-AAGTGTAA-3' at 4533 and complements.
+The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln<sub>50</sub> in TTF-1 HD is utilized for DNA recognition."<ref name=Damante>{{ cite journal
+|author=G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro
-Positive strand, negative direction: 5'-TTATTAAT-3' at 4540, and complement.
+|title=Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain
+|journal=Nucleic Acids Research
-===CadC proximal promoters===
+|date=20 June 1994
+|volume=22
-Negative strand, negative direction: 5'-TTATTAAT-3' at 4227, 5'-ATTATTAA-3' at 4226, 5'-TTATTATT-3' at 4224, 5'-TTTTTATT-3' at 4221, and complements.
+|issue=15
+|pages=3075-83
-Negative strand, positive direction: 5'-TTATAATT-3' at 4169, 5'-TATTGATT-3' at 4163, 5'-TTATTGAT-3' at 4162, 5'-TGATTATT-3' at 4159, 5'-TTAATCAT-3' at 4148, 5'-TTATTAAT-3' at 4145, 5'-TCTTGATT-3' at 4133, 5'-TTATCACT-3' at 4126, and complements.
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC310278/pdf/nar00039-0221.pdf
+|arxiv=
-Positive strand, positive direction: 5'-TTACTCCT-3' at 4097, and complement.
+|bibcode=
+|doi=10.1093/nar/22.15.3075
+|pmid=7915030
+|accessdate=6 May 2020 }}</ref>
-===CadC distal promoters===
+==Hsf1ps==
+{{main|Hsf1p gene transcriptions}}
+The upstream activating sequence (UAS) for the Hsf1p is NGAAN.<ref name=Tang/>
-Negative strand, negative direction: 5'-TTATCTTT-3' at 4081, 5'-TATTTATT-3' at 4075, 5'-TTATTTAT-3' at 4074, 5'-TTTTTATT-3' at 4071, 5'-TTAGGGTT-3' at 3978, 5'-TGGACATT-3' at 3972, 5'-TTACCCTT-3' at 3662, 5'-TCCCTATT-3' at 3656, 5'-TTATGACT-3' at 3542, 5'-TAATGATT-3' at 3472, 5'-ATCTATAA-3' at 3467, 5'-TAACTATT-3' at 3361, 5'-TTAACTAT-3' at 3360, 5'-ATTTTTAA-3' at 3356, 5'-TTATTTGT-3' at 3337, 5'-TGTTTATT-3' at 3334, 5'-ATTTTTAA-3' at 3174, 5'-TTTGTATT-3' at 3169, 5'-TTTTGATT-3' at 3030, 5'-TACCGATT-3' at 3008, 5'-TTACCGAT-3' at 3007, 5'-ATGGATAA-3' at 2997, 5'-TACGAATT-3' at 2936, 5'-TTACGAAT-3' at 2935, 5'-TATATATT-3' at 2873, 5'-TTATATAT-3' at 2872, 5'-TTATATGT-3' at 2641, 5'-TTATCATT-3' at 2501, 5'-TTATGTTT-3' at 2306, 5'-TTATGTTT-3' at 1879, 5'-TAGAAATT-3' at 1735, 5'-ATCTCTAA-3' at 1714, 5'-TTATCTCT-3' at 1712, 5'-ACCCTTAA-3' at 1694, 5'-TTACGGTT-3' at 1636, 5'-ATATATAA-3' at 1601, 5'-TTTGGATT-3' at 1591, 5'-TTATGTCT-3' at 1567, 5'-TGTGAATT-3' at 1546, 5'-TGGACATT-3' at 1133, 5'-TTAGTCCT-3' at 985, 5'-TGGACATT-3' at 803, 5'-TTATGTTT-3' at 770, 5'-TTATGTTT-3' at 636, 5'-TGTGCATT-3' at 533, 5'-TTATGCTT-3' at 493, 5'-TGGACATT-3' at 396, 5'-TCACGATT-3' at 337, 5'-TTGGAATT-3' at 318, 5'-TCTACATT-3' at 247, 5'-TCCATATT-3' at 181, 5'-TGTGGATT-3' at 64, 5'-TTAAGATT-3' at 9, and complements.
+"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."<ref name=Eastmond/>
-Positive strand, negative direction: 5'-TTAAAAAT-3' at 3355, 5'-TTAGATAT-3' at 2982, 5'-TTATCTTT-3' at 1733, 5'-TTAAGTGT-3' at 322, 5'-TTAAGAAT-3' at 196, and complements.
+==Hypoxia response elements==
+{{main|Hypoxia response element gene transcriptions}}
+"Putative ''EPO'' promoter HREs. Location of two conserved potential promoter HREs (pHRE1 and pHRE2; [CACGC]) close to the GATA ([GATA]) and [Wilms tumor gene] WT1 ([GCCTCTCCCCCACCCCCACCCGCG<u>CACGC</u>AC]) sites in the ''EPO'' proximal 5' region. [For human and other vertebrates] is a UCSC Genome Browser output (version hg19), including 161 transcription factor ChIP-sequencing (ChIP-seq) tracks derived from the ENCODE database (version 3), clusters of DNaseI hypersensitivity sites (HSS) from 125 cell types, and the transcriptional start site (TSS), with a closer view of the region in 50 vertebrates extracted using the 100-MULTIZ whole-genome multiple sequence alignment algorithm."<ref name=Orlando>{{ cite journal
+|author=Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger
+|title=Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression
+|journal=Haematologica
+|date=19 December 2019
+|volume=105
+|issue=12
+|pages=2774–2784
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7716368/
+|arxiv=
+|bibcode=
+|doi=10.3324/haematol.2019.236406
+|pmid=33256376
+|accessdate=6 May 2021 }}</ref>
-Negative strand, positive direction: 5'-TTATGACT-3' at 3029, 5'-TTAGGGCT-3' at 2768, 5'-TAGGTATT-3' at 2643, 5'-TTGGGATT-3' at 2545, 5'-TTAAAATT-3' at 2447, 5'-AATTTTAA-3' at 2443, 5'-TGTTTATT-3' at 2347, 5'-TTAAACAT-3' at 2139, 5'-ACAGTTAA-3' at 2135, 5'-TGGCTATT-3' at 1976, 5'-TTTGTATT-3' at 115, and complements.
+==HY boxes==
+{{main|HY box gene transcriptions}}
+"Deletion analysis by a series of 5′-deletion constructs identified the responsive region to RUNX-2 as being between −81 bp and −76 bp, containing a putative RUNX-2 binding sequence (TGAGGG), which is similar to that identified in the promoter region of human interleukin-3 (TGTGGG) (33)."<ref name=Higashikawa>{{ cite journal
+|author=Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi
+|title=Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene
+|journal=Arthritis & Rheumatism
+|date=January 2009
+|volume=60
+|issue=1
+|pages=166-78
+|url=http://onlinelibrary.wiley.com/doi/10.1002/art.24243/full
+|arxiv=
+|bibcode=
+|doi=10.1002/art.24243
+|pmid=19116917
+|accessdate=2013-06-18 }}</ref>
-Positive strand, positive direction: 5'-TTATACCT-3' at 3163, 5'-TTATCTTT-3' at 2629, 5'-TTACACTT-3' at 231, and complements.
+"Deletion, mutagenesis, and tandem repeat analyses identified the core responsive element as the region between −89 and −60 bp (termed the hypertrophy box [HY box]), which showed specific binding to RUNX‐2."<ref name=Higashikawa/>
-==Calcineurin-responsive transcription factors==
+==Initiator elements (YYANWYY)==
-{{main|Calcineurin-responsive transcription factor gene transcriptions}}
+{{main|Initiator element gene transcriptions}}
-The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p) is 5'-TG(A/C)GCCNC-3'.<ref name=Tang/>
+The ''Inr'' has the consensus sequence YYANWYY.<ref name="Xi">{{cite journal
+ | author = Hualin Xi, Yong Yu, Yutao Fu, Jonathan Foley, Anason Halees, and Zhiping Weng
+  | date = June 2007
+ | title = Analysis of overrepresented motifs in human core promoters reveals dual regulatory roles of YY1
+ | journal = Genome Research
+ | volume = 17
+ | issue = 6
+ | pages = 798–806
+ | pmid = 17567998
+ | doi = 10.1101/gr.5754707
+ | id =
+ | url =
+ | accessdate =
+ | pmc = 1891339 }}</ref>
-===CRT distal promoters===
+==Initiator elements (BBCABW)==
+{{main|Initiator element gene transcriptions}}
-Positive strand, negative direction: 5'-GTGGCTCA-3' at 4114, 5'-GTGGCTCA-3' at 3963, 5'-GTGGCTCA-3' at 3054, 5'-GTGGCTCA-3' at 2531, 5'-GTGGCTCA-3' at 2204, 5'-GTGGCTCA-3' at 1769, 5'-GTGGCTCA-3' at 1124, 5'-GTGGCTCA-3' at 660, and complements.
+"Kadonaga and colleagues (Vo ngoc et al. 2017) devised and implemented a novel multistep approach that combines experimental and computational methods to reinvestigate the human Inr consensus sequence. First, they generated two 5′-GRO-seq (5′ end-selected global run-on followed by sequencing) libraries with human MCF-7 cells to identify the 5′ ends of nascent capped transcripts. Second, they developed a peak-calling algorithm named FocusTSS to find transcripts in the 5′-GRO-seq data sets that were initiated at a focused position on the genome, hence identifying clear TSSs to enable analysis of Inr sequences. FocusTSS identified 7678 TSSs that were in both data sets. Third, to identify sequence motifs enriched among the focused TSSs, they used the HOMER motif discovery tool (Heinz et al. 2010), which yielded an Inr-like consensus sequence of BBCABW from −3 to +3 (where, B = C/G/T, W = A/T, and +1 is [A]). Forty percent of the focused TSSs contained a perfect match to the BBCABW consensus Inr."<ref name=Kugel>{{ cite journal
+|author=Jennifer F. Kugel and James A. Goodrich
-Negative strand, positive direction: 5'-TGAGCCAC-3' at 2560, 5'-TGAGCCAC-3' at 1291, and complements.
+|title=Finding the start site: redefining the human initiator element
+|journal=Genes & Development
+|date=2017
+|volume=31
+|issue=1-2
+|pages=1
+|url=http://genesdev.cshlp.org/content/31/1/1.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1101/gad.295980.117
+|pmid=
+|accessdate=9 May 2019 }}</ref>
-Positive strand, positive direction: 5'-GCGGCTCA-3' at 1166, 5'-GCGGCTCA-3' at 1082, 5'-GGGGCTCA-3' at 578, and complements.
+==Initiator-like element, TCT==
+{{main|Initiator element gene transcriptions}}
+Consensus sequence for an Inr-like/TCT is TTCTCT.<ref name=Matsumoto/>
-==Carbohydrate response elements==
+==Inositol/choline-responsive elements==
-{{main|Carbohydrate response element gene transcriptions}}
+{{main|Inositol, choline-responsive element gene transcriptions}}
-A high glucose "HG environment promotes [carbohydrate response element-binding protein] ChREBP translocation to the nucleus leading to formation of a heterodimeric complex with MLX (Max-like protein X) and binding to the carbohydrate response elements (ChoRE) of ChREBP target genes in the nucleus (14-16)."<ref name=Long>{{ cite journal
+"This ICRE (consensus sequence TYTTCACATGY) contains the core sequence CANNTG, which is also known as an E box and which serves as a recognition site for DNA-binding proteins of the basic helix-loop-helix (bHLH) family (3). Members of the bHLH family comprise determinants of cellular differentiation and proliferation in mammalian and invertebrate systems such as the myogenic transcription factors MyoD, MRF4, myogenin and Myf-5(4) as well as factors not restricted to specialized tisues (E12, E47, daughterless, c-Myc and Mad; 5-7). Proteins of the bHLH group may form either homodimers or heterodimers or both, dependent on the individual structure of the respective interaction surface provided by the HLH domain(8)."<ref name=Schwank>{{ cite journal
-|author=Jianyin Long, Daniel L. Galvan, Koki Mise, Yashpal S. Kanwar, Li Li, Naravat Poungavrin, Paul A. Overbeek, Benny H. Chang, and Farhad R. Danesh
+|author=Sabine Schwank, Ronald Ebbert, Karin Rautenstrau𝛃, Eckhart Schweizer and Hans-Joachim Schüller
-|title=Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1
+|title=Yeast transcriptional activator ''IN02'' interacts as an Ino2p/Ino4p basic helix-loop-helix heteromeric complex with the inositol/choline responsive element necessary for expression of phospholipid biosynthetic genes in ''Saccharomyces cerevisiae''
-|journal=Journal of Biological Chemistry
+|journal=Nucleic Acids Research
-|date=28 May 2020
+|date=25 January 1995
-|volume=5
+|volume=23
-|issue=28
+|issue=2
-|pages=
+|pages=230-37
-|url=https://www.jbc.org/content/early/2020/05/28/jbc.RA120.013228.full.pdf
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC306659/pdf/nar00002-0046.pdf
 |arxiv=
 |bibcode=
-|doi=10.1074/jbc.RA120.013228
+|doi=10.1093/nar/23.2.230
 |pmid=
-|accessdate=6 October 2020 }}</ref>
+|accessdate=10 August 2020 }}</ref>
-"The putative ChREBP binding sites ChoRE1 (CACGTG<u>ACCGG</u>ATCTTG, -324 to -308) and ChoRE2 (TCCGCC<u>CCCAT</u>CACGTG, -298 to - 282) were mutated into CACGTG<u>ACGG</u>ATCTTG and TCCGCC<u>CCAT</u>CACGTG respectively, where the 5-nt spacer between the two E-boxes in ChoRE motifs were shortened to 4-nt (underlined) as previously studies showed (10,35)."<ref name=Long/>
+"The UAS INO is thus also referred to as the inositol/choline-responsive element (ICRE). The UAS INO contains the consensus sequence CATGTGAAAT, which includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991)."<ref name=Case>{{ cite book
+|author=Kendall C. Case, Michael Salsaa, Wenxi Yu and Miriam L. Greenberg
+|title=Regulation of Inositol Biosynthesis: Balancing Health and Pathophysiology, In: ''Lipid Signaling in Human Diseases. Handbook of Experimental Pharmacology, vol 259''
+|publisher=Springer
+|location=Cham
+|date=28 December 2018
+|editor=Gomez-Cambronero J., Frohman M.
+|pages=221-260
+|url=https://link.springer.com/chapter/10.1007/164_2018_181
+|arxiv=
+|bibcode=
+|doi=10.1007/164_2018_181
+|pmid=
+|isbn=978-3-030-33667-7
+|accessdate=29 January 2021 }}</ref>
-The E-boxes in ChoRE1 and ChoRE2 are CACGTG and ATCTTG and TCCGCC and CACGTG.<ref name=Long/>
+"All ''IN01'' fusion constructs that retained regulation in response to the phospholipid precursors inositol and choline, contained at least one copy of a nine bp repeated element (consensus, 5'-ATGTGAAAT-3')."<ref name=Lopes>{{ cite journal
+|author=John M. Lopes, Jeanne P. Hirsch, Patricia A. Chorgo, Karen L. Schulze and Susan A. Henry
+|title=Analysis of sequences in the ''INOl'' promoter that are involved in its regulation by phospholipid precursors
+|journal=Nucleic Acids Research
+|date=April 11, 1991
+|volume=19
+|issue=7
+|pages=1687-1693
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC333933/pdf/nar00243-0319.pdf
+|arxiv=
+|bibcode=
+|doi=10.1093/nar/19.7.1687
+|pmid=2027776
+|accessdate=29 January 2021 }}</ref>
-Copying the E-boxes putting these sequences in "⌘F" finds: CACGTG none between ZSCAN22 and A1BG and one between ZNF497 and A1BG, ATCTTG none between ZSCAN22 and A1BG and none between ZNF497 and A1BG, and TCCGCC one between ZSCAN22 and A1BG and none between ZNF497 and A1BG, as can be found by the computer programs.
+==Interferon regulatory factors==
+{{main|Interferon regulatory factor gene transcriptions}}
+Consensus sequence for IRF-3 is 5'-GCTTTCC-3'.<ref name=Long2020/>
-Copying the ChoRE consensus sequence 5'-ACCGGATCTTG-3' or 5'-TCCGCCCCCAT-3' and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.
+There "are totally 11 members (from IRF-1 to IRF-11) identified from vertebrates [10]. All the IRF members share a well-conserved N-terminal helix-turn-helix IRF superfamily domain (also called DNA-binding domain, DBD) with five conserved tryptophan (Trp) residues, which could recognize DNA sequences containing 5’-GAAA-3’ tetranucleotide, such as the IFN-stimulated response element (ISREs, GAAANNGAAA) [11, 12]. Moreover, it was reported that the IRS consensus (-78/-66, AANNGAAA), which existed in the promoter region of IFN-β, could be bound by the IRF family members [13]. As for the C-terminus, most of the IRFs share an IRF-3 superfamily domain, which was also named as IRF associated domain 1 (IAD1). IRF-1 and IRF-2 do not possess conserved IAD1 domain, but they contain non-conserved activation domain (the last 100 amino acids of IRF-1 were rich in tyrosine) or repression domain (the final 25 amino acids of IRF-2 were rich in histidine, arginine and lysine) in their C-terminus, respectively."<ref name=Lu>{{ cite journal
+|author=Mengmeng Lu, Chuanyan Yang, Meijia Li, Qilin Yi, Guangxia Lu, Yichen Wu, Chen Qu, Lingling Wang, and Linsheng Song
+|title=A conserved interferon regulation factor 1 (IRF-1) from Pacific oyster ''Crassostrea gigas'' functioned as an activator of IFN pathway
+|journal=Fish & Shellfish Immunology
+|date=May 2018
+|volume=76
+|issue=May
+|pages=68-77
+|url=https://www.sciencedirect.com/science/article/abs/pii/S105046481830086X
+|arxiv=
+|bibcode=
+|doi=10.1016/j.fsi.2018.02.024
+|pmid=
+|accessdate=27 March 2021 }}</ref>
-Copying the core ChoRE consensus sequence 5'-ACCGG-3' or 5'-CCCAT-3' and putting the sequence in "⌘F" finds one and five between ZSCAN22 and A1BG or six and three between ZNF497 and A1BG as can be found by the computer programs.
+==Jasmonic acid-responsive elements==
+{{main|Jasmonic acid-responsive element gene transcriptions}}
+Jasmonic acid-responsive elements (TGACG, CGTCA).<ref name=Sharma/>
-==CAREs==
+==Krüppel-like factors==
-{{main|CARE gene transcriptions}}
+{{main|Krüppel-like factor gene transcriptions}}
-A CARE occurs in the negative direction: 5'-CAACTC-3' at 86 possibly associated with ZSCAN22. But inverse CAREs occur 5'-CTCAAC-3' at 1406, 5'-CTCAAC-3' at 2592, 5'-CTCAAC-3' at 2704, 5'-CTCAAC-3' at 3115, and 5'-CTCAAC-3' at 4096.
+"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."<ref name=Kulczynska>{{ cite journal
+|author=Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka
+|title=A ''Krüppel-like factor 1 (KLF1)'' Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity
+|journal=Molecular and Cellular Biology
+|date=12 February 2020
+|volume=40
+|issue=5
+|pages=e00444-19
+|url=
+|arxiv=
+|bibcode=
+|doi=10.1128/MCB.00444-19
+|pmid=31818881
+|accessdate=29 August 2020 }}</ref>
-A CARE occurs in the positive direction: 5'-CAACTC-3' at 3292 in the positive direction. But inverse CARE occur 5'-CTCAAC-3' at 1406 and 5'-CTCAAC-3' at 1621 and 5'-CTCAAC-3' at 3290.
+"Using the ''in vitro'' CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."<ref name=Kulczynska/>
-==CArG boxes==
+==Leu3==
-{{main|CArG box gene transcriptions}}
+{{main|Leu3 gene transcriptions}}
-"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of [[MADS box gene transcriptions|MADS box]] proteins (Ito et al., 2008)."<ref name=Fujisawa>{{ cite journal
+With ''HAS1'' ending at zero and ''TDA1'' beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G), 569 - 574 Mig1 (C/T)(C/T)CC(A/G)G and Sdd4 (A/C/T)CCCAC, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T).<ref name=Kim>{{ cite journal
-|author=Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito
+|author=Seungsoo Kim, Maitreya J Dunham, Jay Shendure
-|title=A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening
+|title=A combination of transcription factors mediates inducible interchromosomal contacts
-|journal=The Plant Cell
+|journal=eLife
-|date=5 February 2013
+|date=13 May 2019
-|volume=25
+|volume=8
-|issue=2
+|issue=
-|pages=371-86
+|pages=e42499
-|url=http://www.plantcell.org/content/25/2/371.short
+|url=https://elifesciences.org/articles/42499.pdf
+|arxiv=
+|bibcode=
+|doi=10.7554/eLife.42499.001
+|pmid=
+|accessdate=20 February 2021 }}</ref>
+==M35 boxes==
+{{main|M35 box gene transcriptions}}
+The ''trp'' promoter has a consensus -35 sequence (TTGACA).<ref name=Boer>{{ cite journal
+|author=Herman A. de Boer, Lisa J. Comstock, and Mark Vasser
+|title=The ''tac'' promoter: A functional hybrid derived from the ''trp'' and ''lac'' promoters
+|journal=Proceedings of the National Academy of Sciences USA
+|date=January 1983
+|volume=80
+|issue=1
+|pages=21-5
+|url=http://www.pnas.org/content/80/1/21.full.pdf
 |arxiv=
 |bibcode=
-|doi=10.1105/tpc.112.108118
+|doi=
-|pmid=23386264
+|pmid=
 |accessdate=2017-02-19 }}</ref>
-"MADS-box proteins bind to a consensus sequence, the CArG box, that has the core motif CC(A/T)<sub>6</sub>GG (15)."<ref name=Deng/>
+==M-boxes==
+{{main|M box gene transcriptions}}
-"Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [...]."<ref name=Deng>{{ cite journal
+"The conserved region contains a consensus M-box element (TCACATGA) for binding of MITF. This MITF binding site is aligned and conserved between at least 11 different species [...]. The clear conservation of these elements suggests that ''gpnmb'' has similar regulation in all mammals."<ref name=Ripoll>{{ cite journal
-|author=Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis
+|author=Vera M. Ripoll, Nicholas A. Meadows, Liza-Jane Raggatt, Ming K. Chang, Allison R. Pettit, Alan I. Cassady and David A. Hume
-|title=FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis
+|title=Microphthalmia transcription factor regulates the expression of the novel osteoclast factor GPNMB
-|journal=Proceedings of the National Academy of Sciences United States of America
+|journal=Gene
-|date=19 April 2011
+|date=30 April 2005
-|volume=108
+|volume=413
-|issue=16
+|issue=1-2
-|pages=6680–6685
+|pages=32-41
-|url=http://www.pnas.org/content/108/16/6680.short
+|url=https://research-repository.griffith.edu.au/bitstream/handle/10072/61380/95248_1.pdf?sequence=1
 |arxiv=
 |bibcode=
-|doi=10.1073/pnas.1103175108
+|doi=10.1016/j.gene.2008.01.014
 |pmid=
-|accessdate=2017-09-17 }}</ref>
+|accessdate=18 March 2021 }}</ref>
-Three "other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."<ref name=Deng/> These together with the core motif CC(A/T)<sub>6</sub>GG (15) suggest a more general CArG-box motif of (C(C/A/T)(A/T)<sub>6</sub>(A/G)G).
+==Mcm1 regulatory factors==
+{{main|Mcm1 regulatory factor gene transcriptions}}
+Consensus sequences: NN(A/C/T)(A/C/T)NC(C/T)(A/C/T)(A/C/T)(A/T)(A/C/T)(A/C/T)N(A/G)(C/G/T)(A/C/T)NNN.<ref name=Rossi>{{ cite journal
+|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
+|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
+|journal=Genome Research
+|date=21 March 2018
+|volume=28
+|issue=
+|pages=497-508
+|url=https://genome.cshlp.org/content/28/4/497.full
+|arxiv=
+|bibcode=
+|doi=10.1101/gr.229518.117
+|pmid=29563167
+|accessdate=31 August 2020 }}</ref>
-===CArG box distal promoters===
+The primary consensus sequence is apparently TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
-Positive strand, negative direction: 5'-CATTAAAAGG-3' at 3441, 5'-CAAAAAAAAG-3' at 1399, and complements.
+A "subset of bound and unbound motif occurrences [...] contained all of the most highly conserved nucleotides of the 16-bp pseudosymmetric motif (TTnCCnnnTnnGGnAA) ([...] Shore and Sharrocks 1995; Hughes and de Boer 2013)."<ref name=Rossi/>
-==CAT boxes==
+==Met31ps==
-{{main|CAT box gene transcriptions}}
+{{main|Met31p box gene transcriptions}}
-"The M-CAT consensus sequence [is] CATTCCT".<ref name=Berberich/>
+Consensus sequence for Met31 binding motif is AAACTGTGG in sulfur amino acid metabolism.<ref name=Tang/>
-"A [chloramphenicol acetyltransferase] CAT-box-like element, GCCATT [34], adjacent to the GC-box, is conserved in the three promoters."<ref name=Berberich>{{ cite journal
+"Both Met31p and Met32p bind to the 5′‐AAACTGTG‐3′ core sequence which is, besides the 5′‐TCACGTG‐3′ element, the second regulatory element known to be involved in the regulation of several MET genes (Thomas et al., 1989)."<ref name=Blaiseau>{{ cite journal
-|author=Christof Berberich, Ingolf Dürr, Michael Koenen and Veit Witzemann
+|author=Pierre‐Louis Blaiseau and Dominique Thomas
-|title=Two adjacent E box elements and a M‐CAT box are involved in the muscle‐specific regulation of the rat acetylcholine receptor β subunit gene
+|title=Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA
-|journal=European Journal of Biochemistry
+|journal=The EMBO Journal
-|date=September 1993
+|date=2 November 1998
-|volume=216
+|volume=17
-|issue=2
+|issue=
-|pages=395-404
+|pages=6327-6336
-|url=https://febs.onlinelibrary.wiley.com/doi/pdf/10.1111/j.1432-1033.1993.tb18157.x
+|url=
+|arxiv=
+|bibcode=
+|doi=10.1093/emboj/17.21.6327
+|pmid=
+|accessdate=4 February 2021 }}</ref>
+==Metal responsive elements==
+{{main|Metal responsive element gene transcriptions}}
+"To execute the transcriptional regulation, [Metal-responsive transcription factor-1] MTF-1 binds to the specific site, called [metal responsive element] MRE (core sequence = TGCRCNC), in the promoter region of target gene (Günther et al. 2012a)."<ref name=Lee2017>{{ cite journal
+|author=Sang Yoon Lee & Yoon Kwon Nam
+|title=Molecular cloning of metal-responsive transcription factor-1 (MTF-1) and transcriptional responses to metal and heat stresses in Pacific abalone, ''Haliotis discus hannai''
+|journal=Fisheries and Aquatic Sciences
+|date=3 July 2017
+|volume=20
+|issue=
+|pages=9
+|url=https://fas.biomedcentral.com/articles/10.1186/s41240-017-0055-y
 |arxiv=
 |bibcode=
-|doi=10.1111/j.1432-1033.1993.tb18157.x
+|doi=10.1186/s41240-017-0055-y
 |pmid=
-|accessdate=27 December 2019 }}</ref>
+|accessdate=16 October 2020 }}</ref>
-==C boxes==
+==Middle sporulation elements==
-{{main|C box gene transcriptions}}
+{{main|Middle sporulation element gene transcriptions}}
-"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C-box) [...]."<ref name=Zhang2014/>
+"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."<ref name=Branco>{{ cite journal
+|author=J. Branco, M. Ola, R. M. Silva, E. Fonseca, N. C. Gomes, C. Martins-Cruz, A. P. Silva, A. Silva-Dias, C. Pina-Vaz, C. Erraught, L. Brennan, A. G. Rodrigues, G. Butler and I. M. Miranda
-Analysis "of the recombinant (soybean [''Glycine max''] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."<ref name=Song>{{ cite journal
+|title=Impact of ''ERG3'' mutations and expression of ergosterol genes controlled by ''UPC2'' and NDT80 in ''Candida parapsilosis'' azole resistance
-|author=Young Hun Song, Cheol Min Yoo, An Pio Hong, Seong Hee Kim, Hee Jeong Jeong, Su Young Shin, Hye Jin Kim, Dae-Jin Yun, Chae Oh Lim, Jeong Dong Bahk, Sang Yeol Lee, Ron T. Nagao, Joe L. Key, and Jong Chan Hong
+|journal=Clinical Microbiology and Infection
-|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
+|date=August 2017
-|journal=Plant Physiology
+|volume=23
-|date=April 2008
+|issue=8
-|volume=146
+|pages=575.e1-575.e8
-|issue=4
+|url=https://www.sciencedirect.com/science/article/pii/S1198743X17300903
-|pages=1862–1877
-|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
 |arxiv=
 |bibcode=
-|doi=10.1104/pp.107.113217
+|doi=10.1016/j.cmi.2017.02.002
-|pmid=18287490
+|pmid=28196695
-|accessdate=26 March 2019 }}</ref>
+|accessdate=5 September 2020 }}</ref>
-The human ribosomal protein L11 gene (''HRPL11'') has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].<ref name=Voronina>{{ cite journal
+Of the midsporulation element (MSE), "a minimal element, CRCAAA(A/T), is sufficient for sporulation specificity."<ref name=Ozsarac>{{ cite journal
-|author=E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko
+| author = Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes
-|title=Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
+| title = Regulation of Gene Expression during Meiosis in ''Saccharomyces cerevisiae'': ''SPR3'' Is Controlled by both ABFI and a New Sporulation Control Element
-|journal=Molecular Biology
+| journal = Molecular and Cellular Biology
-|date=2003
+| volume = 17
-|volume=37
+| issue = 3
-|issue=3
+| pages = 1152–9
-|pages=362–371
+| date = March 1997
-|url=https://www.researchgate.net/profile/Elena_Voronina3/publication/263607045_Structural-Functional_Analysis_of_the_Human_Gene_for_Ribosomal_Protein_L11/links/5523af480cf27b5dc3795afa.pdf
+| pmid = 9032242
+| pmc = 231840
+| doi = 10.1128/MCB.17.3.1152 }}</ref>
+==Mig1ps==
+{{main|Mig1p gene transcriptions}}
+The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or 5'-(C/G)(C/T)GGGG-3'.<ref name=Tang/>
+==Msn2,4p==
+{{main|Msn2,4p gene transcriptions}}
+The upstream activating sequence (UAS) for the Msn2,4p transcription factor is 5'-CCCCT-3'.<ref name=Tang/>
+"[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core pentameric cis-acting sequence CCCCT and is located in promoter regions of the induced genes."<ref name=Vamvakas>{{ cite journal
+|author=Sotirios‐Spyridon Vamvakas, John Kapolos, Lambros Farmakis, Gregoria Koskorellou, Fotios Genneos
+|title=Ser625 of msn2 transcription factor is indispensable for ethanol tolerance and alcoholic fermentation process
+|journal=Biotechnology Progress
+|date=14 May 2019
+|volume=35
+|issue=5
+|pages=ee2837
+|url=https://aiche.onlinelibrary.wiley.com/doi/abs/10.1002/btpr.2837
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1002/btpr.2837
 |pmid=
-|accessdate=11 April 2019 }}</ref>
+|accessdate=6 February 2021 }}</ref>
-"Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA)."<ref name=Samarsky>{{ cite journal
+==Musashi binding elements==
-|author=Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand
+{{main|Musashi binding element gene transcriptions}}
-|title=The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization
+"The 24-nt ''Xenopus'' Mos [polyadenylation response element] PRE (Charlesworth ''et al'', 2002) contained a match to the SELEX-derived murine Musashi RNA binding consensus sequence (G/AU<sub>1−3</sub>AGU) (Imai ''et al'', 2001), and included a 3′ U residue essential for PRE function (Charlesworth ''et al'', 2002) [...]."<ref name=Charlesworth>{{ cite journal
-|journal=The European Molecular Biology Organization (EMBO) Journal
+|author=Amanda Charlesworth, Anna Wilczynska, Prajitha Thampi, Linda L Cox, and Angus M MacNicol
-|date=1 July 1998
+|title=Musashi regulates the temporal order of mRNA translation during ''Xenopus'' oocyte maturation
-|volume=17
+|journal=The EMBO Journal
-|issue=13
+|date=21 June 2006
-|pages=3747–3757
+|volume=25
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1170710/pdf/003747.pdf
+|issue=12
+|pages=2792-2801
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1500856/
+|arxiv=
+|bibcode=
+|doi=10.1038/sj.emboj.7601159
+|pmid=16763568
+|accessdate=17 April 2021 }}</ref>
+"Regarding the 3′ UTR ''cis''-regulatory sequences such as AREs (PAS) [110], BRD-Box [111] and MBE [112] mediates negative post-transcriptional regulation by affecting mRNA transcript stability and translational efficiency [110], [140]. In our case, the 3′ ''cis''-regulatory signals, BRD-Box and MBE, located upstream and downstream PAS [...] may regulate tissue-specific alternative polyadenylation which has been detected in approximately 54% of human genes [142]."<ref name=Saravanaperuma>{{ cite journal
+|author=Siva Arumugam Saravanaperuma, Dario Pediconi, Carlo Renieri, Antonietta La Terza
+|title=Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant
+|journal=PLOS ONE
+|date=15 June 2012
+|volume=7
+|issue=6
+|pages=e38657
+|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0038657
 |arxiv=
 |bibcode=
-|doi=10.1093/emboj/17.13.3747
+|doi=10.1371/journal.pone.0038657
-|pmid=9649444
+|pmid=
-|accessdate=2017-02-04 }}</ref>
+|accessdate=17 April 2021 }}</ref>
-Substituting T for U yields C box = 5'-AGTAGT-3' in the translation direction on the template strand.
+"The [Musashi-binding element] MBE consensus sequence is (G/A)U<sub>1–3</sub>AGU."<ref name=Kotani>{{ cite journal
+|author=Tomoya Kotani, Kaori Maehata, Natsumi Takei
+|title=Regulation of Translationally Repressed mRNAs in Zebrafish and Mouse Oocytes, In: ''Oocytes. Results and Problems in Cell Differentiation''
+|publisher=Springer
+|location=Cham
+|date=2017
+|volume=63
+|issue=
+|pages=297-324
+|url=https://link.springer.com/chapter/10.1007/978-3-319-60855-6_13
+|arxiv=
+|bibcode=
+|doi=10.1007/978-3-319-60855-6_13
+|pmid=
+|accessdate=17 April 2021 }}</ref>
-===C-box core promoters===
+==MYB recognition elements==
+{{main|MYB recognition element gene transcriptions}}
-Positive strand, positive direction: 5'-GACGTC-3' at 4316,<ref name=Song/> and complement.
+"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."<ref name=Rushton>{{ cite journal
+|author=Paul J Rushton and Imre E Somssich
-===C-box proximal promoters===
+|title=Transcriptional control of plant genes responsive to pathogens
+|journal=Current Opinion in Plant Biology
-Negative strand, negative direction: 5'-GACGTC-3' at 4316,<ref name=Song/> and complement.
+|date=August 1998
+|volume=1
-===C box distal promoters===
+|issue=4
+|pages=311-5
-Negative strand, negative direction: 5'-AGTAGT-3' at 3521, 5'-AGTAGT-3' at 3418, 5'-AGTAGT-3' at 2944, 5'-AGTAGT-3' at 2888,<ref name=Samarsky/> and complements.
+|url=http://arquivo.ufv.br/dbv/pgfvg/bve684/htms/pdfs_revisao/estresse/transcriptional.pdf
+|arxiv=
-Negative strand, positive direction" 5'-TGTGCAGT-3' at 3962,<ref name=Song/> (hybrid C/G-box) and complement.
+|bibcode=
+|doi=10.1016/1369-5266(88)80052-9
+|pmid=10066598
+|accessdate=5 November 2018 }}</ref>
-Positive strand, negative direction: 5'-GGTGATG-3' at 3798,<ref name=Voronina/> and complement.
+MYB binding site involved in drought induction (TAACTG).<ref name=Sharma/>
-Positive strand, positive direction: 5'-ACTACT-3' at 2144, 5'-AGTAGT-3' at 3251,<ref name=Samarsky/> and complements.
+==Myocyte enhancer factor 2 (MEF2)==
+{{main|Myocyte enhancer factor gene transcriptions}}
+Myocyte enhancer factor-2 (MEF2) [[protein]]s are a family of [[transcription factor]]s which through control of [[gene expression]] are important regulators of [[cellular differentiation]] and consequently play a critical role in embryonic development.<ref name="pmid17959722">{{ cite journal |vauthors=Potthoff MJ, Olson EN | title = MEF2: a central regulator of diverse developmental programs | journal = Development | volume = 134 | issue = 23 | pages = 4131–40 |date=December 2007 | pmid = 17959722
+| doi = 10.1242/dev.008367
+| url =  }}</ref>  In adult organisms, Mef2 proteins mediate the stress response in some tissues.<ref name="pmid17959722"/>
-Positive strand, positive direction: 5'-GACGTC-3' at 3280, 5'-GACGTC-3' at 3231, 5'-GACGTC-3' at 2858, 5'-GACGTC-3' at 1506, 5'-GACGTC-3' at 1120, 5'-GACGTC-3' at 532, 5'-GACGTC-3' at 437, 5'-GACGTC-3' at 193,<ref name=Song/> (C-box) and complements.
+"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."<ref name=Zia>{{ cite journal
+|author=Ayisha Zia, Muhammad Imran, and Sajid Rashid
+|title=In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity
+|journal=Journal of Chemical Information and Modeling
+|date=7 February 2020
+|volume=60
+|issue=3
+|pages=1892-1909
+|url=https://pubs.acs.org/doi/abs/10.1021/acs.jcim.0c00008
+|arxiv=
+|bibcode=
+|doi=10.1021/acs.jcim.0c00008
+|pmid=
+|accessdate=10 September 2020 }}</ref> Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).<ref name=Zia/>
-==CCAAT-box-binding transcription factors==
+==Nanos/Pumilio response elements==
-{{main|Nuclear factor gene transcriptions}}
+{{main|UTR promoter gene transcriptions}}
-CAAT boxes: CCAAT-box-binding transcription factor, TGGCA-binding protein are used by some nuclear factors.<ref name=RefSeq4774>{{ cite web
+"The 3′ UTR of ''eEF1A'' contains a putative [Nanos/Pumilio response element (PRE)] PRE sequence (TGTAAAT), suggesting that it is a Nanos/Pumilio target."<ref name=Oulhen>{{ cite journal
-|vauthors=RefSeq
+|author=Nathalie Oulhen, S. Zachary Swartz, Jessica Laird, Alexandra Mascaro, Gary M. Wessel
-|title=NFIA nuclear factor I A [ Homo sapiens (human) ]
+|title=Transient translational quiescence in primordial germ cells
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
+|journal=Development
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
+|date=1 February 2017
-|date=September 2011
+|volume=144
-|url=https://www.ncbi.nlm.nih.gov/gene/4774
+|issue=7
-|accessdate=4 May 2020 }}</ref>
+|pages=1201
+|url=https://dev.biologists.org/content/144/7/1201
+|arxiv=
+|bibcode=
+|doi=10.1242/dev.144170
+|pmid=
+|accessdate=6 March 2021 }}</ref>
-Copying the consensus sequence for the Hap4p 5'-CCAAT-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.
+Recurrent "kmers occurring in 3′ UTRs were identified in the single-read FLASH data. The polyadenylation signal [ [[ATA box gene transcriptions|ATA box]] ] AATAAA had the highest Z-score, and three similar sequences were also found in the top 10 kmers. However, on correlation with down-regulation, the TGTAAAT motif was found by MEME (Bailey and Elkan 1994) at 294 sites (E-value 2.7 × 10<sup>−562</sup>), which is different from the motif identified by RIP-seq [...]."<ref name=Bharathavikru>{{ cite journal
+|author=Ruthrothaselvi Bharathavikru, Tatiana Dudnakova, Stuart Aitken, Joan Slight, Mara Artibani, Peter Hohenstein, David Tollervey and Nick Hastie
+|title=Transcription factor Wilms’ tumor 1 regulates developmental RNAs through 3′ UTR interaction
+|journal=Genes & Development
+|date=13 March 2017
+|volume=31
+|issue=4
+|pages=347-352
+|url=http://genesdev.cshlp.org/content/31/4/347.full.html
+|arxiv=
+|bibcode=
+|doi=10.1101/gad.291500.116
+|pmid=
+|accessdate=6 March 2021 }}</ref>
-==CGCG boxes==
+==N-boxes==
-{{main|CGCG box gene transcriptions}}
+{{main|N box gene transcriptions}}
-Negative strand in the negative direction there are 2: 5'-GCGCGT-3', 161, 5'-CCGCGC-3', 1761, in the distal promoter.
+"Human pColQ1a carries consensus sequences for transcriptional factors E-protein (E-box, CANNTG), NFAT (GGAAA), c-Ets transcription factor [c-Ets, (C/A)GGA(A/T)], Elk-1, N-box (CCGGAA), and MEF2 (CTAAAAATAA), which play essential roles in muscle-specific and NMJ-specific transcriptional activities (Lee et al., 2004)."<ref name=Huang>{{ cite journal
+|author=Kun Huang, Jin Li, Mikako Ito, Jun-Ichi Takeda, Bisei Ohkawara, Tomoo Ogi, Akio Masuda, and Kinji Ohno
+|title=Gene Expression Profile at the Motor Endplate of the Neuromuscular Junction of Fast-Twitch Muscle
+|journal=Frontiers in Molecular Neuroscience
+|date=8 September 2020
+|volume=13
+|issue=
+|pages=154-165
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7549434/
+|arxiv=
+|bibcode=
+|doi=10.3389/fnmol.2020.00154
+|pmid=33117128
+|accessdate=19 March 2021 }}</ref>
-Positive strand in the negative direction there is 1: 5'-GCGCGG-3', 1762, in the distal promoter.
+"The [basic helix–loop–helix] bHLH proteins from group E were usually bound to the CACGCG [Coupling element] or CACGAG (N-box) motif."<ref name=Bai>{{ cite journal
+|author=Ge Bai, Da-Hai Yang, Peijian Chao, Heng Yao, MingLiang Fei, Yihan Zhang, Xuejun Chen, Bingguang Xiao, Feng Li, Zhen-Yu Wang, Jun Yang and He Xie
+|title=Genome-wide identification and expression analysis of NtbHLH gene family in tobacco (''Nicotiana tabacum L.'') and the role of NtbHLH86 in drought adaptation
+|journal=Plant Diversity
+|date=19 December 2020
+|volume=10
+|issue=
+|pages=4
+|url=https://www.sciencedirect.com/science/article/pii/S2468265920301104
+|arxiv=
+|bibcode=
+|doi=10.1016/j.pld.2020.10.004
+|pmid=
+|accessdate=19 March 2021 }}</ref>
-Negative strand in the positive direction there are 8: between 543 and 1650, in the distal promoter.
+"Group E comprises two families in which the proteins have a conserved Pro or Gly residue within the basic region that mediates preferential binding to the N-box sequences CACGGC or CACGAC."<ref name=Gao>{{ cite journal
+|author=Min Gao, Yanxun Zhu, Jinhua Yang, Hongjing Zhang, Chenxia Cheng, Yucheng Zhang, Ran Wan, Zhangjun Fei & Xiping Wang
-Positive strand in the positive direction there are 22: between 161 and 1769, in the distal promoter.
+|title=Identification of the grape basic helix–loop–helix transcription factor family and characterization of expression patterns in response to different stresses
+|journal=Plant Growth Regulation
-==Cold-responsive elements==
+|date=18 March 2019
-{{main|Cold-responsive element gene transcriptions}}
+|volume=88
-A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."<ref name=Pietzenuk>{{ cite journal
+|issue=
-|author=Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka
+|pages=19-39
-|title=Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements
+|url=https://link.springer.com/article/10.1007/s10725-019-00485-3
-|journal=Genome Biology
-|date=11 October 2016
-|volume=17
-|issue=
-|pages=209
-|url=https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-1072-3
 |arxiv=
 |bibcode=
-|doi=10.1186/s13059-016-1072-3
+|doi=
 |pmid=
-|accessdate=14 September 2020 }}</ref>
+|accessdate=20 March 2021 }}</ref>
-Copying the consensus of the CRE: 5'-CCGAC-3' and putting the sequence in "⌘F" finds 21 locations between ZSCAN22 and A1BG and five locations between ZNF497 and A1BG as can be found by the computer programs.
+"The ''HEY1'' gene binds E-box (CANGTG) and N-box (CACNAG) sites (31,32)."<ref name=Fukusumi>{{ cite journal
+|author=Takahito Fukusumi, Theresa W. Guo, Shuling Ren, Sunny Haft, Chao Liu, Akihiro Sakai, Mizuo Ando, Yuki Saito, Sayed Sadat, and Joseph A. Califano
+|title=Reciprocal activation of ''HEY1'' and ''NOTCH4'' under ''SOX2'' control promotes EMT in head and neck squamous cell carcinoma
+|journal=International Journal of Oncology
+|date=February 2021
+|volume=58
+|issue=2
+|pages=226-237
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7864008/
+|arxiv=
+|bibcode=
+|doi=10.3892/ijo.2020.5156
+|pmid=33491747
+|accessdate=21 March 2021 }}</ref>
-==Coupling elements==
+The "putative consensus binding sites of Notch target genes in human IDE promoter" included the N-box from "the first translation start site (ATG)" -3711/-3715 position in a forward (+) orientation with a consensus sequence of CACNAG of the bHLH protein HES-1 with a strong DNA binding activity.<ref name=Leal>{{ cite journal
-{{main|Coupling element gene transcriptions}}
+|author=María C. Leal, Ezequiel I. Surace, María P. Holgado, Carina C. Ferrari, Rodolfo Tarelli, Fernando Pitossi, Thomas Wisniewski, Eduardo M. Castaño, and Laura Morelli
-"In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996)."<ref name=Watanabe/>
+|title=Notch signaling proteins HES-1 and Hey-1 bind to insulin degrading enzyme (IDE) proximal promoter and repress its transcription and activity: Implications for cellular Aβ metabolism
+|journal=Biochim Biophys Acta
+|date=19 October 2011
+|volume=1823
+|issue=2
+|pages=227-235
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3307219/
+|arxiv=
+|bibcode=
+|doi=10.1016/j.bbamcr.2011.09.014
+|pmid=22036964
+|accessdate=21 March 2021 }}</ref> For the closer binding position -310/-305 in a reverse (-) orientation of the bHLH protein Hey-1 CACNAG had a weak DNA binding activity.<ref name=Leal/> The "Class C" DNA binding site at position -379/-374 in a reverse (-) orientation with a consensus sequence of CACGNG of the bHLH Hey-1 protein had a strong DNA binding activity.<ref name=Leal/>
-"In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."<ref name=Watanabe/>
+==Non-DiTyrosine 80 transcription factors==
+{{main|Ndt80p gene transcriptions}}
+"The ''Saccharomyces cerevisiae''  Ndt80 protein is the founding member of a class of p53-like transcription factors that is known as the NDT80/PhoG-like DNA-binding family."<ref name=Katz>{{ cite journal
+|author=Margaret E Katz and Sarah Cooper
+|title=Extreme Diversity in the Regulation of Ndt80-Like Transcription Factors in Fungi
+|journal=G3 Genes|Genomes|Genetics
+|date=1 December 2015
+|volume=5
+|issue=12
+|pages=2783–2792
+|url=https://academic.oup.com/g3journal/article/5/12/2783/6028954
+|arxiv=
+|bibcode=
+|doi=10.1534/g3.115.021378
+|pmid=
+|accessdate=8 February 2021 }}</ref>
-==CRE boxes==
+Ndt80 [Non-DiTyrosine 80] is a meiosis-specific transcription factor required for successful completion of meiosis and spore formation.<ref name=Xu>{{ cite journal
-{{main|CRE box gene transcriptions}}
+| vauthors = Xu L, Ajimura M, Padmore R, Klein C, Kleckner N
-"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."<ref name=Montminy>{{ cite journal
+| title = NDT80, a meiosis-specific gene required for exit from pachytene in ''Saccharomyces cerevisiae''
-|author=Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman
+| journal = Molecular and Cellular Biology
-|title=Identification of a cyclic-AMP-responsive element within the rat somatostatin gene
+| volume = 15
-|journal=Proceedings of the National Academy of Sciences of the USA
+| issue = 12
-|date=September 1986
+| pages = 6572–81
-|volume=83
+|date = December 1995
-|issue=18
+|pmid = 8524222
-|pages=6382-6
+| pmc = 230910
-|url=http://www.pnas.org/content/pnas/83/18/6682.full.pdf
+| doi = 10.1128/MCB.15.12.6572 }}</ref> The DNA-binding domain of Ndt80 has been isolated, and the structure reveals that this protein is a member of the Ig-fold family of transcription factors.<ref name=Lamoureux>{{ cite journal
-|arxiv=
+| vauthors = Lamoureux JS, Stuart D, Tsang R, Wu C, Glover JN
-|bibcode=
+| title = Structure of the sporulation-specific transcription factor Ndt80 bound to DNA
-|doi=
+| journal = The EMBO Journal
-|pmid=2875459
+| volume = 21
-|accessdate=17 September 2018 }}</ref>
+| issue = 21
+| pages = 5721–32
+| date = November 2002
+| pmid = 12411490
+| pmc = 131069
+| doi = 10.1093/emboj/cdf572 }}</ref> Ndt80 also competes with the repressor SUM1 for binding to promoters containing MSEs.<ref name=Hendrickson>{{ cite journal
+| vauthors = Hendrickson WA, Ward KB
+| title = Atomic models for the polypeptide backbones of myohemerythrin and hemerythrin
+| journal = Biochemical and Biophysical Research Communications
+| volume = 66
+| issue = 4
+| pages = 1349–56
+| date = October 1975
+| pmid = 5
+| doi = 10.1016/0006-291x(75)90508-2 }}</ref>
-The upstream activating sequence (UAS) for the Aca1p, the basic "leucine zipper (bZIP) transcription factor [55] involved in carbon source utilization" is 5'-TGACGTCA-3'<ref name=Tang/> the same as a CRE.
+Direct "binding of Ndt80 to the [mid sporulation element CRCAAAA/T (Ozsarac et al. 1997)] MSE is necessary for activating transcription of the middle sporulation genes."<ref name=Chu>{{ cite journal
+| author = Shelley Chu and Ira Herskowitz
+| title = Gametogenesis in Yeast Is Regulated by a Transcriptional Cascade Dependent on Ndt80
+| journal = Molecular Cell
+| volume = 1
+| issue = 5
+| pages = 685–96
+| date = April 1, 1998
+| pmid = 9660952
+| doi = 10.1016/S1097-2765(00)80068-4 }}</ref>
-The upstream activating sequence (UAS) for the Sko1p, involved "in osmotic and oxidative stress responses" is 5'-TGACGTCA-3'<ref name=Tang/> the same as a CRE.
+"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."<ref name=Branco/>
-===CRE box proximal promoters===
+==Nuclear factor of activated T cell transcriptions==
+{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)}}
-Negative strand in the negative direction there is 1: 5'-TGACGTCA-3', 4317, and complement.
+Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).<sup>3</sup>"<ref name=Jain>{{ cite journal
+|author=Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao
-==D boxes==
+|title=A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region
-{{main|C and D box gene transcriptions}}
+|journal=Journal of Biological Chemistry
-{{main|D box gene transcriptions}}
+|date=24 February 1995
-There is one D box<ref name=Samarsky/> in the distal promoter: 5'-AGTCTG-3' at 2947 on the negative strand in the negative direction and its complement on the positive strand.
+|volume=270
+|issue=8
-Positive strand in the negative direction there is 1: 5'-AGTCTG-3', 1355.
+|pages=4138-4145
+|url=https://www.jbc.org/content/270/8/4138.full.pdf
-Inverse complement, positive strand, negative direction there are 2: 5'-CAGACT-3', 15, 5'-CAGACT-3', 1616.
-There is one D box in the distal promoter: 5'-AGTCTG-3' at 3923 on the negative strand in the positive direction and its complement on the positive strand.
-Inverse complement, negative strand, positive direction there are 2: 5'-CAGACT-3', 1744, 5'-CAGACT-3', 2416.
-Inverse complement, positive strand, positive direction there are 3: 5'-CAGACT-3', 2943, 5'-CAGACT-3', 3006, 5'-CAGACT-3', 3924.
-The human ribosomal protein L11 gene (''HRPL11'') has two potential snRNA-coding sequences in intron 4: a D box beginning at +4237 (TCCTG).<ref name=Voronina>{{ cite journal
-|author=E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko
-|title=Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
-|journal=Molecular Biology
-|date=2003
-|volume=37
-|issue=3
-|pages=362–371
-|url=https://www.researchgate.net/profile/Elena_Voronina3/publication/263607045_Structural-Functional_Analysis_of_the_Human_Gene_for_Ribosomal_Protein_L11/links/5523af480cf27b5dc3795afa.pdf
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1074/jbc.270.8.4138
-|pmid=
+|pmid=7876165
-|accessdate=11 April 2019 }}</ref>
+|accessdate=15 August 2020 }}</ref>
-Copying the consensus of the D-box: 5'-TCCTG-3'<ref name=Voronina/> and putting the sequence in "⌘F" finds three locations between ZSCAN22 and A1BG and nine locations between ZNF497 and A1BG as can be found by the computer programs.
+==Nuclear factor 1==
+{{main|Nuclear factor gene transcriptions}}
-D-box (TGAGTGG).<ref name=Motojima/>
+Nuclear factor 1 (NF-1) is a family of closely related [[transcription factor]]s that constitutively bind as dimers to specific sequences of DNA with high affinity.<ref name=Blomquist>{{ cite journal
+|vauthors=Blomquist P, Belikov S, Wrange O
-Copying the consensus of the D-box: 5'-TGAGTGG-3' and putting the sequence in "⌘F" finds no locations between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
+|title=Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure
+|journal=Nucleic Acids Research
-==Downstream B recognition elements==
+|volume=27
-{{main|Downstream TFIIB recognition element gene transcriptions}}
+|issue=2
-# negative strand in the negative direction, looking for 5'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-3', 59: between 68 and 4458 and their complements.
+|pages=517–25
-# negative strand in the positive direction, looking for 5'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-3', 11: between 56 and 4397 and their complements.
+|date=January 1999
-# positive strand in the negative direction, looking for 5'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-3', 31: between 43 and 4110 and their complements.
+|pmid=9862974
-# positive strand in the positive direction, looking for 5'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-3', 19: between 72 and 4328 and their complements.
+|pmc=148209
-# inverse, negative strand, negative direction, is SuccessablesdBREi--.bas, looking for 5'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-3': 44 between 230 and 4454 and their complements.
+|doi= 10.1093/nar/27.2.517
-# inverse, negative strand, positive direction, is SuccessablesdBREi-+.bas, looking for 5'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-3', 16: between 59 and 4398 and their complements.
+|url= }}</ref> Family members contain an unusual [[DNA binding domain]] that binds to the [[recognition sequence]] 5'-TTGGCXXXXXGCCAA-3'.<ref name=Boron>{{ cite book
-# inverse, positive strand, negative direction, is SuccessablesdBREi+-.bas, looking for 5'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-3', 16: between 217 and 3945 and their complements.
+|author=Walter F. Boron
-# inverse, positive strand, positive direction, is SuccessablesdBREi++.bas, looking for 5'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-3', 14: between 72 and 4287 and their complements.
+|title=Medical Physiology: A Cellular And Molecular Approach
+|publisher=Elsevier/Saunders
+|location=
+|year=2003
+|pages=125–126
+|isbn=1-4160-2328-3
+|oclc=
+|doi= }}</ref>
-==Downstream core elements==
+Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.<ref name=Yao2016/>
-{{main|Downstream core element gene transcriptions}}
-In the negative direction on the negative strand, the A1BG transcription start site is at 4460 nucleotides from the last nucleotide of the gene ZSCAN22. In the positive direction on the negative strand, the A1BG transcription start site is at 4300 from well within the gene ZNF497. Downstream core elements are expected downstream of these TSSs. Occurrences before the TSSs can be found on [[Downstream core element gene transcriptions]].
+An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).
-# positive strand, negative direction, looking for DCE SI: 5'-CTTC-3' at 4528.
+==Nutrient-sensing response element 1==
-# negative strand, negative direction, looking for DCE SII: 5'-CTGT-3', 2, 5'-CTGT-3' at 4468 , 5'-CTGT-3' at 4507.
+There is only one nucleotide difference between the ''SESN2'' CARE and the ATF4-inducible asparagine synthase gene ''ASNS'' consensus sequence (GTTTCATCA).<ref name=Garaeva>{{ cite journal
-# negative strand, positive direction, looking for DCE SII: 5'-CTGT-3', 1, 5'-CTGT-3' at 4392.
+|author=Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva
-# positive strand, positive direction, looking for DCE SII: 5'-CTGT-3', 1, 5'-CTGT-3' at 4332.
+|title=Mitochondrial dysfunction induces ''SESN2'' gene expression through Activating Transcription Factor 4
+|journal=Cell Cycle
-# negative strand, positive direction, looking for DCE SIII: 5'-AGC-3', 1, 5'-AGC-3' at 4352.
+|date=15 January 2016
-# positive strand, negative direction, looking for DCE SIII: 5'-AGC-3', 3, 5'-AGC-3' at 4480, 5'-AGC-3' at 4489, 5'-AGC-3' at 4520.
+|volume=15
-# positive strand, positive direction, looking for DCE SIII: 5'-AGC-3', 1, 5'-AGC-3' at 4374.
+|issue=1
+|pages=64-71
-===Complements===
+|url=https://www.tandfonline.com/doi/full/10.1080/15384101.2015.1120929
-# negative strand, negative direction, looking for DCE SIc: 5'-GAAG-3', 1, 5'-GAAG-3' at 4528.
+|arxiv=
+|bibcode=
+|doi=10.1080/15384101.2015.1120929
+|pmid=26771712
+|accessdate=5 September 2020 }}</ref>
-# negative strand, positive direction, looking for DCE SIIc: 5'-GACA-3', 1, 5'-GACA-3' at 4332.
+==Oaf1 transcription factors==
-# positive strand, negative direction, looking for DCE SIIc: 5'-GACA-3', 2, 5'-GACA-3' at 4468, 5'-GACA-3' at 4507.
+{{main|Oaf1p gene transcriptions}}
-# positive strand, positive direction, looking for DCE SIIc: 5'-GAAG-3', 1, 5'-GACA-3' at 4392.
+The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG-3'.<ref name=Tang/>
-# negative strand, negative direction, looking for DCE SIIIc: 5'-TCG-3', 3, 5'-TCG-3' at 4480, 5'-TCG-3' at 4489, 5'-TCG-3' at 4520.
+==ORE1 binding sites==
-# negative strand, positive direction, looking for DCE SIIIc: 5'-TCG-3', 1, 5'-TCG-3' at 4374.
+{{main|ORE1 binding site gene transcriptions}}
-# positive strand, positive direction, looking for DCE SIIIc: 5'-TCG-3', 1, 5'-TCG-3' at 4352.
+"As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [37]."<ref name=Qiu/>
-===Inverse complements===
+Consensus sequences are 5'-(A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G)-3' or 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.<ref name=Qiu/>
-# looking for DCE SIci: 5'-GAAG-3', same as the complements.
+==p53 response elements==
+{{main|P53 response element gene transcriptions}}
+"A p53 consensus DNA RE is composed of a tandem of two decameric palindromic sequences (half-sites) 5′-RRRCWWGYYY-3′, where R = purine, Y = pyrimidine and W is either A or T. There is a variability in composition of p53 REs, thus two half-sites can be separated by a spacer DNA, typically 0–13 bp in length and many p53 DNA REs have varying numbers of half-sites (19,20,22,33–37)."<ref name=Kearns>{{ cite journal
+|author=Sinéad Kearns, Rudi Lurz, Elena V. Orlova, Andrei L. Okorokov
+|title=Two p53 tetramers bind one consensus DNA response element
+|journal=Nucleic Acid Research
+|date=27 July 2016
+|volume=44
+|issue=13
+|pages=6185–6199
+|url=https://academic.oup.com/nar/article/44/13/6185/2457565
+|arxiv=
+|bibcode=
+|doi=10.1093/nar/gkw215
+|pmid=
+|accessdate=6 October 2020 }}</ref>
-# positive strand, negative direction, looking for DCE SIIci: 5'-ACAG-3', 1, 5'-ACAG-3' at 4517.
+p53 response elements found in the promoter of TUG1: 5'-CAGGCCC-3' and 5'-GGGCGTG-3'.<ref name=Long2020/>
-# positive strand, positive direction, looking for DCE SIIci: 5'-ACAG-3', 1, 5'-ACAG-3' at 4366.
-# negative strand, negative direction, looking for DCE SIIIci: 5'-GCT-3', 1, 5'-GCT-3' at 4471.
+==P boxes==
-# negative strand, positive direction, looking for DCE SIIIci: 5'-GCT-3', 4, 5'-GCT-3' at 4312, 5'-GCT-3' at 4321, 5'-GCT-3' at 4372, 5'-GCT-3' at 4390.
+{{main|P box gene transcriptions}}
-# positive strand, positive direction, looking for DCE SIIIci: 5'-GCT-3', 1, 5'-GCT-3' at 4356.
+"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu>{{ cite journal
+|author=Wangjie Yu and Paul E. Hardin
+|title=Circadian oscillators of ''Drosophila'' and mammals
+|journal=Journal of Cell Science
+|date=2006
+|volume=119
+|issue=
+|pages=4793-5
+|url=http://jcs.biologists.org/content/119/23/4793.short
+|arxiv=
+|bibcode=
+|doi=10.1242/jcs.03174
+|pmid=17130292
+|accessdate=2017-02-19 }}</ref>
-===Inverses===
+==Peroxisome proliferator-activated receptor alpha==
+{{main|Peroxisome proliferator-activated receptor alpha}}
+Consensus sequence is 5'-CGACCCC-3'.<ref name=Long2020/>
-# looking for DCE SIi: 5'-CTTC-3', same as the direct transcript.
+==Phosphate starvation-response transcription factors==
+{{main|Phosphate starvation-response transcription factor gene transcriptions}}
-# negative strand, negative direction, looking for DCE SIIi: 5'-TGTC-3', 1, 5'-TGTC-3' at 4517.
+"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
-# negative strand, positive direction, looking for DCE SIIi: 5'-TGTC-3', 1, 5'-TGTC-3' at 4366.
+|author=Matthew J. Rossi
+|author2=William K.M. Lai
-# negative strand, positive direction, looking for DCE SIIIi: 5'-CGA-3', 1, 5'-CGA-3' at 4356.
+|author3=B. Franklin Pugh
-# positive strand, negative direction, looking for DCE SIIIi: 5'-CGA-3', 1, 5'-CGA-3' at 4471.
+|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
-# positive strand, positive direction, looking for DCE SIIIi: 5'-CGA-3', 4, 5'-CGA-3' at 4312, 5'-CGA-3' at 4321, 5'-CGA-3' at 4372, 5'-CGA-3' at 4390.
+|journal=Genome Research
+|date=21 March 2018
-==Downstream promoter elements==
+|volume=28
-{{main|Downstream promoter element gene transcriptions}}
+|issue=
-# negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesDPE--.bas, looking for 5'-A/G-G-A/T-C/T-A/C/G-3', 163: between 35 and 4546, and their complements.
+|pages=497-508
-# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesDPE-+.bas, looking for 5'-A/G-G-A/T-C/T-A/C/G-3', 73: between 37 and 4420, and their complements.
+|url=https://genome.cshlp.org/content/28/4/497.full
-# positive strand in the negative direction is SuccessablesDPE+-.bas, looking for 5'-A/G-G-A/T-C/T-A/C/G-3', 101: between 32 and 4507, and their complements.
+|arxiv=
-# positive strand in the positive direction is SuccessablesDPE++.bas, looking for 5'-A/G-G-A/T-C/T-A/C/G-3', 159: between 8 and 4424, and their complements.
+|bibcode=
-# inverse, negative strand, negative direction, is SuccessablesDPEi--.bas, looking for 5'-A/C/G-C/T-A/T-G-A/G-3', 58: between 32 and 4476,
+|doi=10.1101/gr.229518.117
-# inverse, negative strand, positive direction, is SuccessablesDPEi-+.bas, looking for 5'-A/C/G-C/T-A/T-G-A/G-3', 152: between 8 and 4424.
+|pmid=29563167
-# inverse, positive strand, negative direction, is SuccessablesDPEi+-.bas, looking for 5'-A/C/G-C/T-A/T-G-A/G-3', 174: between 13 and 4546,
+|accessdate=31 August 2020 }}</ref>
-# inverse, positive strand, positive direction, is SuccessablesDPEi++.bas, looking for 5'-A/C/G-C/T-A/T-G-A/G-3', 95: between 30 and 4420.
-{{clear}}
-Consensus sequence for the DPE is 5'-AGTCTC-3'.<ref name=Matsumoto/>
-==E2 boxes==
-{{main|E2 box gene transcriptions}}
-Negative strand in the negative direction there are 5: 5'-ACAGATGT-3', 482, 5'-ACAGATGT-3', 1225, 5'-GCAGTTGG-3', 1514, 5'-ACAGATGT-3', 2989, 5'-ACAGATGT-3', 4213, in the distal promoter.
-Positive strand in the negative direction there are 2: 5'-GCAGGTGG-3', 2571, 5'-ACAGATGA-3', 3920.
+The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.<ref name=Shao/>
-Inverse complement, negative strand, negative direction there is 1: 5'-CCACCTGT-3', 2117.
+The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of ''HIS4'' and ''PHO5'' regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].<ref name=Tang/>
+==Pollen1 elements==
+{{main|Pollen1 element gene transcriptions}}
+"Electrophoretic mobility shift assays identified a pollen-specific ''cis''-acting element POLLEN1 (AGAAA) mapped at ''AtACBP4'' (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."<ref name=Ye/>
-Inverse complement, positive strand, negative direction there are 4: 5'-CCACCTGT-3', 394, 5'-ACACCTGT-3', 1131, 5'-GCAACTGC-3', 3851, 5'-ACACCTGT-3', 3970
+"Given that ''AtACBP4pro::GUS'' (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 ''cis''-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."<ref name=Ye/>
-Negative strand in the positive direction there is 1: 5'-GCAGATGA-3', 37.
+"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato ''LAT52'' (Bate and Twell 1998)."<ref name=Ye/>
-==EIN3 binding sites==
+==Polycomb response elements==
-{{main|EIN3 binding site gene transcriptions}}
+{{main|Polycomb response element gene transcriptions}}
-"We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gene [...]."<ref name=Qiu>{{ cite journal
+"Two predicted [Pleiohomeotic] Pho-Phol binding sites, CGCCATTT, that closely resemble the extended Pho-Phol consensus sequence, CGCCAT(T/A)TT (Kahn et al. 2014), are located within PRE1.1 [...]."<ref name=Ghotbi>{{ cite journal
-|author=Kai Qiu, Zhongpeng Li, Zhen Yang, Junyi Chen, Shouxin Wu, Xiaoyu Zhu, Shan Gao, Jiong Gao, Guodong Ren, Benke Kuai, and Xin Zhou
+|author=Elnaz Ghotbi, Kristina Lackey, Vicki Wong, Katie T. Thompson, Evan G. Caston, Minna Haddadi, Judith Benes and Richard S. Jones
-|title=EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in ''Arabidopsis''
+|title=Differential Contributions of DNA-Binding Proteins to Polycomb Response Element Activity at the ''Drosophila giant'' Gene
-|journal=PLoS Genetics
+|journal=Genetics
-|date=July 2015
+|date=1 March 2020
-|volume=11
+|volume=214
-|issue=7
+|issue=3
-|pages=e1005399
+|pages=623-634
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4517869/
+|url=https://www.researchgate.net/profile/Richard_Jones26/publication/338510352_Differential_Contributions_of_DNA_Binding_Proteins_to_Polycomb_Response_Element_Activity_at_the_Drosophila_giant_Gene/links/5e3852c792851c7f7f1a3210/Differential-Contributions-of-DNA-Binding-Proteins-to-Polycomb-Response-Element-Activity-at-the-Drosophila-giant-Gene.pdf
 |arxiv=
 |bibcode=
-|doi=10.1371/journal.pgen.1005399
+|doi=10.1534/genetics.119.302981
-|pmid=26218222
+|pmid=31919108
-|accessdate=4 October 2020 }}</ref>
+|accessdate=7 September 2020 }}</ref>
-"EIN3/EIL1 transcription factors were reported to bind to a consensus DNA sequence of A[CT]G[AT]A[CT]CT [34,35]."<ref name=Qiu/>
+==Pribnow boxes==
+{{main|Pribnow box gene transcriptions}}
+"Two domains upstream of the start site of transcription have been identified for which a consensus sequence has been formulated(1-5). These domains are the -35 sequence (5'-T-T-G-A-C-A) and the Pribnow box (5'-T-A-T-A-A-T) in the -10 region. Both domains are in close contact with the RNA polymerase during initiation of RNAsynthesis (2,6)."<ref name=Boer>{{ cite journal
+|author=Herman A. de Boer, Lisa J. Comstock, and Mark Vasser
+|title=The ''tac'' promoter: A functional hybrid derived from the ''trp''and ''lac'' promoters
+|journal=Proceedings of the National Academy of Sciences USA
+|month=January
+|year=1983
+|volume=80
+|issue=1
+|pages=21-5
+|url=http://www.pnas.org/content/80/1/21.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|accessdate=2017-02-19 }}</ref>
-==Endosperm expression==
+==Prolamin boxes==
-{{main|Endosperm expression gene transcriptions}}
+{{main|Prolamin box gene transcriptions}}
-Endosperm expression (TGTGTCA).<ref name=Sharma/>
+"The main cis-element present in their promoters is an endosperm-specific box [19,20], which consists of two motifs: a GLM (GCN4-like motif) (5′ G(A)TGA(G) GTCAT 3′) that shares homology with yeast GCN4 [21], and a 7 bp P-box (Prolamin box) (5′TGTAAAG3′) [22–24]."<ref name=Ruta>{{ cite journal
+|author=Veronica Ruta, Chiara Longo, Andrea Lepri, Veronica De Angelis, Sara Occhigrossi, Paolo Costantino and Paola Vittorioso
+|title=The DOF Transcription Factors in Seed and Seedling Development
+|journal=Plants
+|date=8 February 2020
+|volume=9
+|issue=2
+|pages=218
+|url=https://www.mdpi.com/2223-7747/9/2/218/pdf
+|arxiv=
+|bibcode=
+|doi=10.3390/plants9020218
+|pmid=
+|accessdate=7 January 2021 }}</ref>
-Copying an apparent consensus sequence of TGTGTCA and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
+==Pyrimidine boxes==
+{{main|Pyrimidine box gene transcriptions}}
+"Prediction of cis-regulatory elements using bioinformatics tools: Upstream 1500bp sequence of transcriptional start site of each gene were searched using PLANTCARE database to identify the cis-regulatory elements of NtSUT1-5 genes. Moreover, manual scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."<ref name=Abiramavalli>{{ cite journal
+|author=M. Abiramavalli and B. Usha
+|title=Identification, characterization and expression analysis of sucrose transporters in the model plant ''Nicotiana tabacum'' cv.petit havana
+|journal=Journal of Environmental Biology
+|date=7 July 2020
+|volume=41
+|issue=
+|pages=803-811
+|url=http://www.jeb.co.in/journal_issues/202007_jul20/paper_20.pdf
+|arxiv=
+|bibcode=
+|doi=10.22438/jeb/41/4/MRN-1233
+|pmid=
+|accessdate=7 January 2021 }}</ref>
-==Enhancer boxes==
+"Promoter analysis of five SUTs revealed the presence of sugar responsive element, A-box (TACGTA), which is involved in regulation of sucrose transporters upon addition of sucrose (Kühn, 2011; Osuna et al., 2007). Sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) important for sugar responsive gene expression, pyrimidine box (CCTTTT) (Washio, 2003) partially involved in sugar repression were also observed."<ref name=Abiramavalli/>
-{{main|Enhancer box gene transcriptions}}
-===Core promoters===
+==Q elements==
+{{main|Q element gene transcriptions}}
+"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."<ref name=Ye>{{ cite journal
+|author=Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye
+|title=Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism
+|journal=Plant Molecular Biology
+|date=January 2017
+|volume=93
+|issue=
+|pages=209-225
+|url=https://www.researchgate.net/profile/Jianxin_Shi6/publication/309799453_Kelch-motif_containing_acyl-CoA_binding_proteins_AtACBP4_and_AtACBP5_are_differentially_expressed_and_function_in_floral_lipid_metabolism/links/5d11201c458515c11cf5f6b1/Kelch-motif-containing-acyl-CoA-binding-proteins-AtACBP4-and-AtACBP5-are-differentially-expressed-and-function-in-floral-lipid-metabolism.pdf
+|arxiv=
+|bibcode=
+|doi=10.1007/s11103-016-0557-5
+|pmid=27826761
+|accessdate=7 May 2020 }}</ref>
-===Proximal promoters===
+The consensus sequence for a Q element is 5'-AGGTCA-3'.<ref name=Ye/>
-Negative strand, negative direction there is 1: 5'-CAGATG-3' at 4212.
+==Quinone reductase response elements==
+{{main|Xenobiotic response element gene transcriptions}}
+The quinone reductase (QRDRE) gene contains TCCCCTTGCGTG which has the DRE core of TNGCGTG.<ref name=Yao>{{ cite journal
+| vauthors = Yao EF, Denison MS
+| title = DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer
+| journal = Biochemistry
+| volume = 31
+| issue = 21
+| pages = 5060–7
+| date = June 1992
+| pmid = 1318077
+| doi = 10.1021/bi00136a019 }}</ref>
-Positive strand, positive direction there is 1: 5'-CAAGTG-3' at 4202.
+==Rap1 regulatory factors==
+{{main|Rap1 regulatory factor gene transcriptions}}
-===Distal promoters===
+Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).<ref name=Rossi/>
-Negative strand in the negative direction there are 9: between 324 and 3482.
+"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."<ref name=Rossi/>
-Positive strand in the negative direction there are 21: between 41 and 4011.
+Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.
-Negative strand in the positive direction there are 26: between 196 and 4015.
+==Reb1 general regulatory factors==
+{{main|Reb1 general regulatory factor gene transcriptions}}
+Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
-Positive strand in the positive direction there are 10: between 186 and 3936.
+Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.
-==Ethylene responsive elements==
+==Retinoblastoma control elements==
-{{main|Ethylene responsive element gene transcriptions}}
+{{main|TC element gene transcriptions}}
-Ethylene responsive elements (ATTTCAAA).<ref name=Sharma/>
+"Robbins ''et al.'' (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-''fos'' and have identified an element, termed the retinoblastoma control element (RCE), in the c-''fos'' promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-''β''1, -''β''2, and -''β''3 promoters by Kim ''et al.'' (19)."<ref name=Pietenpol>{{ cite journal
+|author=Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses
-Copying an apparent consensus sequence of ATTTCAAA and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
+|title=Factor-binding element in the human c-''myc'' promoter involved in transcriptional regulation by transforming growth factor ''β''1 and by the retinoblastoma gene product
+|journal=Proceedings of the National Academy of Sciences USA
-==F boxes==
+|date=November 15, 1991
-{{main|F box gene transcriptions}}
+|volume=88
+|issue=22
-"Male sex determination in the ''Caenorhabditis elegans'' hermaphrodite germline requires translational repression of tra-2 mRNA by the [Germ Line Development] GLD-1 RNA binding protein."<ref name=Clifford>{{ cite journal
+|pages=10227-10231
-|author=Robert Clifford, Min-Ho Lee, Sudhir Nayak, Mitsue Ohmachi, Flav Giorgini and Tim Schedl
+|url=http://www.pnas.org/content/pnas/88/22/10227.full.pdf
-|title=FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the ''C. elegans'' hermaphrodite germline
-|journal=Development
-|date=December 2000
-|volume=127
-|issue=24
-|pages=5265-76
-|url=https://dev.biologists.org/content/develop/127/24/5265.full.pdf
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1073/pnas.88.22.10227
-|pmid=11076749
+|pmid=1946442
-|accessdate=10 August 2020 }}</ref>
+|accessdate=5 December 2018 }}</ref>
-Skp, Cullin, F-box containing complex (or SCF complex)  is a multi-protein E3 [[ubiquitin ligase]] complex that catalyzes the [[ubiquitin]]ation of proteins destined for 26S [[Proteasome|proteasomal]] degradation.<ref name=Ou>{{ Cite journal
+"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."<ref name=Sato>{{ cite journal
-|last1=Ou|first1=Young
+|author=Hiroshi Sato, Megumi Kita, and Motoharu Seiki
-|title=The Centrosome in Higher Organisms: Structure, Composition, and Duplication
+|title=v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements
-|volume=238
+|journal=The Journal of Biological Chemistry
-|date=2004
+|date=5 November 1993
-|journal=International Review of Cytology
+|volume=268
-|pages=119–182
+|issue=31
-|isbn=978-0-12-364642-2
+|pages=23460-8
-|last2=Rattner|first2=J.B.
+|url=https://www.jbc.org/content/268/31/23460.full.pdf
-|doi=10.1016/s0074-7696(04)38003-4
+|arxiv=
-|pmid=15364198 }}</ref>
+|bibcode=
+|doi=
+|pmid=8226872
+|accessdate=13 August 2020 }}</ref>
-"Canonical F-box proteins act as bridging components of the SCF ubiquitin ligase complex; the N-terminal F-box binds a Skp1 homolog, recruiting ubiquination machinery, while a C-terminal protein-protein interaction domain binds a specific substrate for degradation."<ref name=Clifford/>
+"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-''O''-tetradecanoylphorbol-13-acetate (TPA) (15-20)."<ref name=Sato/>
-==GAAC elements==
+Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."<ref name=Sato/>
-{{main|GAAC element gene transcriptions}}
-# negative strand in the negative direction, looking for 5'-GAACT-3', 13: between 843 and 4294 and complements,
-# negative strand in the positive direction, looking for 5'-GAACT-3', 1, 5'-GAACT-3', 609 and complement,
-# positive strand in the negative direction, looking for 5'-GAACT-3', 2, 5'-GAACT-3', 1685, 5'-GAACT-3', 3460 and complements,
-# positive strand in the positive direction, looking for 5'-GAACT-3', 2, 5'-GAACT-3', 577, 5'-GAACT-3', 692 and complements,
-# inverse complement, negative strand, negative direction, looking for 5'-AGTTC-3', 3: between 3844 and 4178 and complements,
-# inverse complement, negative strand, positive direction, looking for 5'-AGTTC-3', 1, 5'-AGTTC-3', 761 and complement,
-# inverse complement, positive strand, negative direction, looking for 5'-AGTTC-3', 6: between 253 and 4417.
-==GA responsive elements==
+Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-''O''-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).<ref name=Sato/>
-{{main|GARE gene transcriptions}}
-Only one GARE (an inverse) occurs: between ZSCAN22 and A1BG 5'-AAACAAT-3' at 230 nts and its complement.
-==GATA boxes==
+"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human ''PAI-1'' gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."<ref name=Motojima>{{ cite journal
-{{main|GATA gene transcriptions}}
+|author=Masaru Motojima, Takao Ando and Toshimasa Yoshioka
+|title=Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (''PAI-1'') gene expression in mesangial cells
-GTGA-box has the consensus sequence GATA.<ref name=Ye/>
+|journal=Biomedical Journal
+|date=10 July 2000
+|volume=349
+|issue=2
+|pages=435-441
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1221166/pdf/10880342.pdf
+|arxiv=
+|bibcode=
+|doi=10.1042/0264-6021:3490435
+|pmid=10880342
+|accessdate=13 August 2020 }}</ref>
-===Proximal promoters===
+"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."<ref name=Motojima/>
-Inverse complement, negative strand, positive direction there is 1: 5'-TTTATCAC-3', 4125.
+D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).<ref name=Motojima/>
-===Distal promoters===
+==Retinoic acid response elements==
+{{main|Retinoic acid response element gene transcriptions}}
+Retinoic acid response elements (RAREs).
-Positive strand in the negative direction there are 2: 5'-GGGATAGA-3', 100, 5'-ATGATAGA-3', 355.
+"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."<ref name=Kumar>{{ cite journal
+|author=Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq
+|title=A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome
+|journal=Frontiers in Human Neuroscience
+|date=9 August 2016
+|volume=10
+|issue=
+|pages=403
+|url=https://www.frontiersin.org/articles/10.3389/fnhum.2016.00403/full
+|arxiv=
+|bibcode=
+|doi=10.3389/fnhum.2016.00403
+|pmid=27555815
+|accessdate=7 September 2020 }}</ref>
-Inverse complement, negative strand, negative direction there is 1: 5'-GTTATCAT-3', 2500.
+"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."<ref name=Gu>{{ cite journal
+|author=Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang
+|title=Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region
+|journal=Pediatric Research
+|date=July 2016
+|volume=80
+|issue=1
+|pages=159-168
+|url=https://www.nature.com/articles/pr201647
+|arxiv=
+|bibcode=
+|doi=10.1038/pr.2016.47
+|pmid=26991262
+|accessdate=7 September 2020 }}</ref>
-Inverse complement, positive strand, negative direction there is 1: 5'-TTTATCTT-3', 1732.
+"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, [[Complex locus A1BG and ZNF497#Vitamin D response elements|vitamin D receptors]] (VDR) and [[Complex locus A1BG and ZNF497#Peroxisome proliferator hormone response elements|peroxisome proliferator-activated receptors]] (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."<ref name=Gu/>
-Inverse complement, negative strand, positive direction there is 1: 5'-GTTATCCC-3', 3385.
+Additional response elements that include the 5'-AGGTCA-3' are [[Complex locus A1BG and ZNF497#Q elements|Q elements]], [[Complex locus A1BG and ZNF497#ROR-response elements|ROR-response elements]] and [[Complex locus A1BG and ZNF497#Thyroid hormone response elements|Thyroid hormone response elements]].
-Inverse complement, positive strand, positive direction there are 2: 5'-GCTATCAG-3', 1840, 5'-TTTATCTT-3', 2628.
+A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.<ref name=Gu/>
-==GC boxes==
+Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
-{{main|GC box gene transcriptions}}
-GC box (GGGCGG).<ref name=Sato/>
+==Rgt1 transcription factors==
+{{main|Rgt1p gene transcriptions}}
+"Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between ''HAS1pr-TDA1pr'' alleles in saturated cultures of ''Saccharomyces'' yeast is mediated by three transcription factors, Leu3, Sdd4 (Ypr022c), and Rgt1. The coincident, combined binding of all three factors is strongest at the ''HAS1pr-TDA1pr'' locus and is also specific to saturated conditions. We applied MAP-C to further explore the biochemical mechanism of these contacts, and find they require the structured regulatory domain of Rgt1, but no known interaction partners of Rgt1."<ref name=Kim>{{ cite journal
+|author=Seungsoo Kim, Maitreya J Dunham, Jay Shendure
+|title=A combination of transcription factors mediates inducible interchromosomal contacts
+|journal=eLife
+|date=13 May 2019
+|volume=8
+|issue=
+|pages=e42499
+|url=https://elifesciences.org/articles/42499.pdf
+|arxiv=
+|bibcode=
+|doi=10.7554/eLife.42499.001
+|pmid=
+|accessdate=20 February 2021 }}</ref>
-Positive strand in the negative direction there are 2; 5'-TGGGCGTGGT-3', 1898, 5'-TGGGCGTGGT-3', 3048, in the distal promoter.
+With ''HAS1'' ending at zero and ''TDA1'' beginning at above 1000 bp, 585 - 592 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 610 - 617 Rgt1 (A/T)(A/T)N(A/T)(C/T)CCG, 630 - 637 Rgt CGG(A/G)(A/T)N(A/T)(A/T), the third Rgt1 is the inverse of the first two.<ref name=Kim/>
-Inverse complement, negative strand, negative direction there is 1: 5'-ACTCCGCCCA-3', 3092.
+Rgt1 is also known as glucose transporter gene repressor.
-Inverse complement, positive strand, negative direction there is 1: 5'-GCTCCGCCTC-3', 1505.
+==Root specific elements==
+{{main|Root specific element gene transcriptions}}
+Root specific elements (TGACGTCA).<ref name=Sharma/>
-Negative strand in the positive direction there is 1: 5'-TGGGCGGGAC-3', 409.
+==ROR-response elements==
+{{main|ROR-response element gene transcriptions}}
-Inverse complement, positive strand, positive direction there is 1:, 5'-GCCACGCCCC-3', 491.
+RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)<sup>13, 31</sup>."<ref name=Wang2016>{{ cite journal
+|author=Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen
+|title=ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
+|journal=Nature Medicine
+|date=May 2016
+|volume=22
+|issue=5
+|pages=488-496
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5030109/
+|arxiv=
+|bibcode=
+|doi=10.1038/nm.4070
+|pmid=27019329
+|accessdate=6 September 2020 }}</ref>
-==Gibberellin responsive elements==
+Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-{{main|Gibberellin responsive element gene transcriptions}}
-Gibberellin responsive elements (CCTTTTG, AAACAGA).<ref name=Sharma/>
-Copying an apparent consensus sequence of CCTTTTG, AAACAGA and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and two between ZNF497 and A1BG as can be found by the computer programs.
+Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Glucocorticoid response elements==
+==R response elements==
-{{main|Glucocorticoid response element gene transcriptions}}
+{{main|MYB recognition element gene transcriptions}}
-"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."<ref name=Parsonnet>{{ cite journal
+The consensus sequence for the RRE is 5'-CATCTG-3'.<ref name=Hartmann>{{ cite journal
-|author=Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke
+|author=Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar
-|title=The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity
+|title=Differential combinatorial interactions of ''cis''-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes
-|journal=Nucleic Acids Research
+|journal=Plant Molecular Biology
-|date=5 September 2019
+|date=January 2005
-|volume=47
+|volume=57
-|issue=15
+|issue=2
-|pages=8180-8192
+|pages=155–171
-|url=https://academic.oup.com/nar/article/47/15/8180/5506867
+|url=http://pubman.mpdl.mpg.de/pubman/item/escidoc:1222162/component/escidoc:1222161/hartmann_weisshaar_pmb_2005.pdf
 |arxiv=
 |bibcode=
-|doi=10.1093/nar/gkz486
+|doi=10.1007/s11103-004-6910-0
-|pmid=31147715
+|pmid=15821875
-|accessdate=28 August 2020 }}</ref>
+|accessdate=10 November 2018 }}</ref>
-Copying an apparent consensus sequence of AGAACA and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and two between ZNF497 and A1BG as can be found by the computer programs.
+==Serum response elements==
+{{main|CArG box gene transcriptions}}
-==Gcr1ps==
+{{main|Enhancer box gene transcriptions}}
-{{main|Gcr1p gene transcriptions}}
+{{main|Serum response element gene transcriptions}}
+The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
-The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in the regulation of glycolysis [77].<ref name=Tang/>
+|author=Ravi P. Misra
+|author2=Azad Bonni
-Copying an apparent consensus sequence of 5'-CTTCC-3' and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and six between ZNF497 and A1BG as can be found by the computer programs.
+|author3=Cindy K. Miranti
+|author4=Victor M. Rivera
+|author5=Morgan Sheng
+|author6=Michael E.Greenberg
+|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
+|journal=The Journal of Biological Chemistry
+|date=14 October 1994
+|volume=269
+|issue=41
+|pages=25483-25493
+|url=http://www.jbc.org/content/269/41/25483.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=7929249
+|accessdate=7 December 2019 }}</ref>
-==H boxes==
+'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.
-{{main|H box gene transcriptions}}
-===Core promoters===
+'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.
-Between ZSCAN22 and A1BG: There is one inverse and its complement 5'-AGGAGA-3' at 4428 nts.
+'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".
-Between ZNF497 and A1BG: There is an inverse and its complement 5'-AGGACA-3' at 4252. There is five after the TSS: between 4387 and 4392 and their complements.
+'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.
-===Proximal promoters===
+==Servenius sequences==
+{{main|Servenius sequence gene transcriptions}}
-Between ZSCAN22 and A1BG: There is one H box (5'-ANANNA-3'): negative direction, negative strand, 5'-ACACGA-3' at 4402. On the positive strand in the negative direction there are 16: between 4216 and 4395, with their complements on the negative strand, negative direction.
+The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."<ref name=Cogswell>{{ cite journal
+|author=John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting
-Between ZNF497 and A1BG: There is one H box (5'-ANANNA-3'): 5'-AGAGAA-3' at 4387 in the proximal promoter, negative strand, positive direction. There are four: between 4365 and 4392 and their complements in the positive direction.
+|title=X-box-binding proteins positively and negatively regulate transcription of the ''HLA-DRA'' gene through interaction with discrete upstream W and V elements
+|journal=Proceedings of the National Academy of Sciences USA
-===Distal promoters===
+|date=October 1990
+|volume=87
-Between ZSCAN22 and A1BG, negative strand, negative direction: 5'-AGAGGA-3' at 3387, 5'-AGAGGA-3' at 3638, and 5'-AGAGGA-3' at 3675. One inverse and its complement 5'-AGGAGA-3' at 3790. There are 14 H boxes: between 788 and 4124.
+|issue=19
+|pages=7703-7707
-On the positive strand, negative direction, there are 127 H boxes: between 608 and 4395.
+|url=https://www.pnas.org/content/pnas/87/19/7703.full.pdf
+|arxiv=
-Between ZNF497 and A1BG: There are two H boxes after nucleotide number 2300 in the negative strand and positive direction: between 420 and 530, and 5'-ACACCA-3' at 2603 and 5'-ACACCA-3' at 3825.
+|bibcode=
+|doi=10.1073/pnas.87.19.7703
-There are two H boxes after nucleotide number 2300 in the positive strand and positive direction: 5'-ACACCA-3' at 204, 5'-ACACCA-3' at 528, 5'-ACACCA-3' at 3643 and 5'-ACACCA-3' at 3967.
+|pmid=2120707
+|accessdate=20 August 2020 }}</ref>
-Regarding 5'-ANANNA-3', on the negative strand, positive direction, there are 25 H boxes: between 2591 and 4154.
+==Specificity proteins==
+{{main|Specificity protein gene transcriptions}}
+{{main|Sp1 gene transcriptions}}
+Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).<ref name=Motojima/>
-On the positive strand, positive direction there are 20 H boxes: between 2347 and 4168.
+"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."<ref name=Motojima/>
-There inverses on the negative strand in the positive direction of 31 H boxes: between 2412 and 4166.
+Sp-1 (CCGCCCC).<ref name=Sato/>
-==HMG boxes==
+Sp1 (GCGGC).<ref name=Yao2016>{{ cite journal
-{{main|HMG box gene transcriptions}}
+|author=D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor
+|title=Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid
-"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."<ref name=Laudet>{{ cite journal
+|journal=Journal of Dairy Science
-|author=Vincent Laudet, Dominique Stehelin and Hans Clevers
+|date=May 2016
-|title=Ancestry and diversity of the HMG box superfamily
+|volume=99
-|journal=Nucleic Acids Research
+|issue=5
-|date=1993
+|pages=3945-3957
-|volume=21
+|url=https://www.sciencedirect.com/science/article/pii/S0022030216300273
-|issue=10
-|pages=2493-501
-|url=https://academic.oup.com/nar/article-pdf/21/10/2493/4086740/21-10-2493.pdf
 |arxiv=
 |bibcode=
-|doi=10.1093/nar/21.10.2493
+|doi=10.3168/jds.2015-10601
-|pmid=8506143
+|pmid=26947306
-|accessdate=2017-04-05 }}</ref>
+|accessdate=5 September 2020 }}</ref>
+SP1 (GGGGCGGGCC).<ref name=Long2020/>
-Copying an apparent consensus sequence of (A/T)(A/T)CAAAG and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
+An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 5'-(C/G)(C/G/T)G(C/G)C(C/T)-3'. Or, each must be considered separately.
-==HNFs==
+Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.
-{{main|HNF gene transcriptions}}
-Gene ID: 6927 is [[HNF1A]] HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."<ref name=RefSeq6927>{{ cite book
-|vauthors=RefSeq
-|title=HNF1A HNF1 homeobox A [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=April 2015
-|url=https://www.ncbi.nlm.nih.gov/gene/6927
-|accessdate=7 November 2018 }}</ref>
-"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1."<ref name=Li2020/> TCF-1 binding site is CCTTTGA.<ref name=Li2020>{{ cite journal
+==STATs==
-|author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
+{{main|STAT gene transcriptions}}
-|title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
+A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.<sup>(37–40)</sup>"<ref name=Ghislain>{{ cite journal
-|journal=Oncogene
+|author=Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish
-|date=July 2020
+|title=The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds ''In Vitro'' to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes
-|volume=39
+|journal=Journal of Interferon and Cytokine Research
-|issue=29
+|date=June 2001
-|pages=5187-5200
+|volume=21
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7398576/
+|issue=6
+|pages=379-388
+|url=https://www.researchgate.net/profile/Thomas_Wong29/publication/11899907_The_Interferon-Inducible_Stat2Stat1_Heterodimer_Preferentially_Binds_In_Vitro_to_a_Consensus_Element_Found_in_the_Promoters_of_a_Subset_of_Interferon-Stimulated_Genes/links/5ade147aaca272fdaf88c226/The-Interferon-Inducible-Stat2Stat1-Heterodimer-Preferentially-Binds-In-Vitro-to-a-Consensus-Element-Found-in-the-Promoters-of-a-Subset-of-Interferon-Stimulated-Genes.pdf
 |arxiv=
 |bibcode=
-|doi=10.1038/s41388-020-1344-y
+|doi=10.1089/107999001750277
-|pmid=32555331
+|pmid=11440635
-|accessdate=29 August 2020 }}</ref>
+|accessdate=15 August 2020 }}</ref> Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.<ref name=Ghislain/>
-"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."<ref name="Gardmo">{{cite journal
+"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."<ref name=Wesoly>{{ cite journal
-|author=Cissi Gardmo and Agneta Mode
+|author=Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen
-|date=1 December 2006
+|title=STAT activation and differential complex formation dictate selectivity of interferon responses
-|title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression
+|journal=Acta Biochimica Polonica
-|url=http://jme.endocrinology-journals.org/content/37/3/433.full
+|date=31 March 2007
-|journal=Journal of Molecular Endocrinology
+|volume=54
-|volume=37
+|issue=1
-|issue=3
+|pages=27-38
-|pages=433-441
+|url=https://ojs.ptbioch.edu.pl/index.php/abp/article/download/3266/2324
 |arxiv=
 |bibcode=
-|doi=10.1677/jme.1.02116
+|doi=10.18388/abp.2007_3266
-|pmid=17170084
+|pmid=17351669
-|accessdate=2017-09-01 }}</ref>
+|accessdate=15 August 2020 }}</ref>
-===HNF6 core promoters===
+==Ste12p==
+{{main|Ste12p gene transcriptions}}
+The upstream activating sequence (UAS) for [Sterile 12 protein] Ste12p is 5'-TGAAAC-3'.<ref name=Tang/>
-Inverse complement, positive strand, negative direction there is 1: 5'-TTATTAATTC-3', 4542.
+==Sucrose boxes==
+{{main|Sucrose box gene transcriptions}}
+Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."<ref name=Abiramavalli/>
-===HNF6 proximal promoters===
+==Synaptic Activity-Responsive Elements==
+{{main|Synaptic Activity-Responsive Elements}}
-Negative strand in the negative direction there is 1: 5'-TTATTAATCG-3', 4229.
+"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."<ref name=Tornos>{{ cite journal
+|author=Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto
-Negative strand in the positive direction there are 2: 5'-TTATTAATCA-3', 4147, 5'-TTATTGATTA-3', 4164.
+|title=Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF
+|journal=PLoS ONE
-Inverse complement, positive strand, positive direction there are 1: 5'-ATATTAACAA-3', 4172.
+|date=31 January 2013
+|volume=8
-===HNF6 distal promoters===
+|issue=1
+|pages=e53848
-Negative strand in the negative direction there are 2: 5'-GTGTTAATAA-3', 1725, 5'-TAGTTGATAA-3', 3527.
+|url=https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0053848&type=printable
+|arxiv=
-Positive strand in the negative direction there is 1: 5'-AAATTGATAA-3', 3361.
+|bibcode=
+|doi=10.1371/journal.pone.0053848
+|pmid=23382855
+|accessdate=12 November 2018 }}</ref>
-Inverse complement, negative strand, negative direction there are 2: 5'-ACATGGACAT-3', 802, 5'-TAATGAACTT-3', 1301.
+"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."<ref name=Montminy/>
-Inverse complement, positive strand, negative direction there are 2: 5'-AAATTGATAA-3', 3361, 5'-TCATCAACTA-3', 3525.
+The consensus sequence for the myocyte enhancer factor 2 (MEF2) is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).<ref name=Zia/>
-Negative strand in the positive direction there are 1: 5'-ATGTCCATGG-3', 3581.
+The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra/>
-Positive strand in the positive direction there is 1: 5'-GAGTCCATTG-3', 3732.
+==TACTAAC boxes==
+{{main|TACTAAC box gene transcriptions}}
+"A consensus sequence TACTAA(C/T) was derived for the branch site of ''Dictyostelium'' introns."<ref name=Rivero>{{ cite journal
+|author=Francisco Rivero
+|title=mRNA processing in Dictyostelium: sequence requirements for termination and splicing
+|journal=Protist
+|date=June 2002
+|volume=153
+|issue=2
+|pages=169-76
+|url=http://www.academia.edu/download/45750040/1434-4610-0009520160518-7945-1y17rxg.pdf
+|arxiv=
+|bibcode=
+|doi=10.1078/1434-4610-00095
+|pmid=12125758
+|accessdate=2017-04-05 }}</ref>
-Inverse complement, positive strand, positive direction there is 1: 5'-CCATTGACTC-3', 3736.
+==TAGteams==
+{{main|TAGteam gene transcriptions}}
-==Homeoboxes==
+The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."<ref name=Fonseca>{{ cite journal
-{{main|Homeobox gene transcriptions}}
+|author=Rodrigo Nunes da Fonseca and Thiago M. Venancio
-"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."<ref name=Kalousova>{{ cite journal
+|title=Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda
-|author=Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik
+|journal=Plos Genetics
-|title=DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4
+|date=1 March 2018
-|journal=Biochemical and Biophysical Research Communications
+|volume=14
-|date=June 1999
-|volume=259
 |issue=3
-|pages=510-518
+|pages=e1007201
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0006291X99908094
+|url=https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007201
 |arxiv=
 |bibcode=
-|doi=
+|doi=10.1371/journal.pgen.1007201
-|pmid=10364449
+|pmid=29494591
-|accessdate=6 May 2020 }}</ref>
+|accessdate=5 September 2020 }}</ref>
+Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.
-The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln<sub>50</sub> in TTF-1 HD is utilized for DNA recognition."<ref name=Damante>{{ cite journal
+==Tapetum boxes==
-|author=G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro
+{{main|Tapetum box gene transcriptions}}
-|title=Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain
+The consensus sequence for the TAPETUM box is TCGTGT.<ref name=Ye/>
-|journal=Nucleic Acids Research
-|date=20 June 1994
-|volume=22
-|issue=15
-|pages=3075-83
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC310278/pdf/nar00039-0221.pdf
-|arxiv=
-|bibcode=
-|doi=10.1093/nar/22.15.3075
-|pmid=7915030
-|accessdate=6 May 2020 }}</ref>
-Copying a portion of the homeobox motif of CAAG and putting it in "⌘F" finds eight located between ZSCAN22 and A1BG and 21 between ZNF497 and A1BG as can be found by the computer programs.
+==TATA boxes==
+{{main|TATA box gene transcriptions}}
+"About 24% of human genes have a TATA-like element and their promoters are generally AT-rich; however, only ~10% of these TATA-containing promoters have the canonical TATA box (TATAWAWR)."<ref name=Yang>{{ cite journal
+| doi = 10.1016/j.gene.2006.09.029
+| author = C Yang, E Bolotin, T Jiang, FM Sladek, E Martinez
+| title = Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters
+| journal = Gene
+| date= March 2007
+| volume = 389
+| issue = 1
+| pages = 52–65
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1955227/?tool=pubmed
+| pmid = 17123746 }}</ref>
-==Hsf1ps==
+==TAT boxes==
-{{main|Hsf1p gene transcriptions}}
+{{main|TAT box gene transcriptions}}
-The upstream activating sequence (UAS) for the Hsf1p is 5'-NGAAN-3' or 5'-(A/C/G/T)GAA(A/C/G/T)-3'.<ref name=Tang/>
+Only an inverse and its complement occurs between ZSCAN22 and A1BG: 5'-TACCTAT-3' at 2996 nts from ZSCAN22.
-Copying 5'-TGAAA-3' in "⌘F" yields twelve between ZSCAN22 and A1BG and 5'-CGAAC-3' one between ZNF497 and A1BG as can be found by the computer programs.
+==T boxes==
+{{main|T box gene transcriptions}}
-==Hypoxia response elements==
+"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."<ref name=Conlon>{{ cite journal
-{{main|ABA-response element gene transcriptions}}
+|author=Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith
-"The hypoxia response element (HRE) and estrogen response element (ERE) were located on −154 to −150 "ACGTG", and −94 to −80 "AGGTTATTGCCTCCT" on the transcript, respectively."<ref name=Matsumoto>{{ cite journal
+|title=Determinants of T box protein specificity
-|author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima
+|journal=Development
-|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
+|date=2001
-|journal=Fisheries Science
+|volume=128
-|date=9 August 2020
+|issue=19
-|volume=86
+|pages=3749-3758
-|issue=
+|url=http://dev.biologists.org/content/develop/128/19/3749.full.pdf?download=true
-|pages=873-887
-|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
 |arxiv=
 |bibcode=
-|doi=10.1007/s12562-020-01451-z
+|doi=
-|pmid=
+|pmid=11585801
-|accessdate=27 September 2020 }}</ref>
+|accessdate=17 November 2018 }}</ref>
-Copying 5'-ACGTG-3' in "⌘F" yields eight between ZSCAN22 and A1BG and 5'-CGAAC-3' one between ZNF497 and A1BG as can be found by the computer programs.
+"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."<ref name=Zhang2014/>
-==HY boxes==
+"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."<ref name=Liu>{{ cite journal
-{{main|HY box gene transcriptions}}
+|author=Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko
+|title=Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites
-===Core promoters===
+|journal=Proceedings of the National Academy of Sciences of the USA
+|date=25 October 2016
-Positive strand in the negative direction there is 1: 5'-TGAGGG-3' at 4558.
+|volume=113
+|issue=43
-Inverse complement, negative strand, negative direction there is 1: 5'-CCCTCA-3', 4498.
+|pages=E6572-E6581
+|url=https://www.pnas.org/content/113/43/E6572
-Negative strand in the positive direction there is 1: 5'-TGTGGG-3', 4395.
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.1613914113
+|pmid=27791029
+|accessdate=28 August 2020 }}</ref>
-===Distal promoters===
+==TEA consensus sequences==
+{{main|TEA consensus sequence gene transcriptions}}
+"The TEA/ATTS transcription factor family consists of mammalian, avian, nematode, insect and fungal members that share a conserved TEA domain. The TEA domain (Bürglin, 1991) represents a DNA‐binding region that is composed of 66–76 conserved amino acids (aa) in the N‐terminal section of the proteins."<ref name=Schweizer>{{ cite journal
+|author=Anja Schweizer, Steffen Rupp, Brad N. Taylor, Martin Röllinghoff, Klaus Schröppel
+|title=The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in ''Candida albicans''
+|journal=Molecular Microbiology
+|date=November 2000
+|volume=38
+|issue=3
+|pages=435-445
+|url=https://onlinelibrary.wiley.com/doi/full/10.1046/j.1365-2958.2000.02132.x
+|arxiv=
+|bibcode=
+|doi=10.1046/j.1365-2958.2000.02132.x
+|pmid=
+|accessdate=21 April 2021 }}</ref>
-Negative strand in the negative direction there is 1: 5'-TGTGGG-3' at 749.
+"The TEA consensus sequence (TCS) in a fungal TEA/ATTS transcription factor target promoter has been defined as 5′‐CATTCY‐3′ (Andrianopoulos and Timberlake, 1994)."<ref name=Schweizer/>
-Positive strand in the negative direction there are 4: between 88 and 3712.
+==Tec1ps==
+{{main|Tec1p gene transcriptions}}
+The upstream activating sequence (UAS) for Tec1p is 5'-GAATGT-3'.<ref name=Tang/>
-Inverse complement, negative strand, negative direction there are 3: between 2702 and 3889.
+==Telomeric repeat DNA-binding factors==
+{{main|Telomeric repeat DNA-binding factor gene transcriptions}}
+In the nucleotides between ZSCAN22 and A1BG there is are ten 5'-TTAGGG-3' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.
-Positive strand in the positive direction there are 2: 5'-TGTGGG-3', 2965, 5'-TGTGGG-3', 3533.
+''Homo sapiens'' genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".<ref name=Maru>{{ cite book
+|author=Yoshiro Maru
+|title=Basic Research, In: "Inflammation and Metastasis"
+|publisher=Springer
+|location=Tokyo
+|date=2016
+|editor=
+|pages=193-231
+|url=https://link.springer.com/chapter/10.1007/978-4-431-56024-1_10
+|arxiv=
+|bibcode=
+|doi=10.1007/978-4-431-56024-1_10
+|pmid=
+|isbn=978-4-431-56022-7
+|accessdate=28 August 2020 }}</ref>
-Negative strand in the positive direction there are 3: between 258 and 3879.
+==Thyroid hormone response elements==
+{{main|Thyroid hormone response element gene transcriptions}}
+"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."<ref name=Pinto>{{ cite journal
+|author=Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford
+|title=Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation
+|journal=Endocrinology
+|date=1 September 2017
+|volume=158
+|issue=9
+|pages=3067-3078
+|url=https://academic.oup.com/endo/article/158/9/3067/3979086
+|arxiv=
+|bibcode=
+|doi=10.1210/en.2017-00314
+|pmid=28911178
+|accessdate=5 September 2020 }}</ref>
-Inverse complement, negative strand, positive direction there are 3: between 88 and 3503.
+==Transcription factor 3==
+{{main|Transcription factor 3 gene transcriptions}}
+Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a [[protein]] that in humans is encoded by the ''[[TCF3]]'' [[gene]].<ref name="pmid2308859">{{cite journal | vauthors = Henthorn P, McCarrick-Walmsley R, Kadesch T | title = Sequence of the cDNA encoding ITF-1, a positive-acting transcription factor | journal = Nucleic Acids Research | volume = 18 | issue = 3 | pages = 677 | date = February 1990 | pmid = 2308859 | doi = 10.1093/nar/18.3.677 | url = http://nar.oxfordjournals.org/cgi/pmidlookup?view=long&pmid=2308859 }}</ref><ref name="pmid1967983">{{cite journal | vauthors = Kamps MP, Murre C, Sun XH, Baltimore D | title = A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL | journal = Cell | volume = 60 | issue = 4 | pages = 547–55 | date = February 1990 | pmid = 1967983 | doi = 10.1016/0092-8674(90)90658-2 }}</ref> TCF3 has been shown to directly enhance Hes1 (a well-known target of [[Notch signaling]]) expression.<ref>[http://jem.rupress.org/content/203/5/1329.full.pdf E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment]</ref>
-Inverse complement, positive strand, positive direction there is 5: between 494 and 3185.
+This gene encodes a member of the E protein (class I) family of [[helix-loop-helix]] [[transcription factor]]s. The 9aaTAD transactivation domains of E proteins and MLL are very similar and both bind to the KIX domain of general transcriptional mediator CBP.<ref name=Piskacek>{{cite journal|author=Piskacek S
+|title=Nine-amino-acid transactivation domain: Establishment and prediction utilities
+|journal=Genomics|date=2007|doi=10.1016/j.ygeno.2007.02.003|volume=89|issue=6|pages=756–768|pmid=17467953}}</ref><ref>{{cite journal|last1=Piskacek|first1=Martin|last2=Vasku|first2=A|last3=Hajek|first3=R|last4=Knight|first4=A|title=Shared structural features of the 9aaTAD family in complex with CBP|journal=Mol. Biosyst.|date=2015|doi=10.1039/c4mb00672k|volume=11|issue=3|pages=844–851|pmid=25564305 }}</ref>  E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for [[B lymphocyte|B]] and [[T lymphocyte]] development.<ref name=RefSeq6929>{{ cite web
+|author=RefSeq
+|title=TCF3 transcription factor 3 [ Homo sapiens (human) ]
+|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
+|location=8600 Rockville Pike, Bethesda MD, 20894 USA
+|date=September 2011
+|url=https://www.ncbi.nlm.nih.gov/gene/6929
+|accessdate=22 November 2020 }}</ref>
-==Initiator elements (YYANWYY)==
+Consensus sequence found in the promoter of TUG1 is 5'-GTCTGGT-3'.<ref name=Long2020/>
-{{main|Initiator element gene transcriptions}}
-===Core promoters===
+==Translational control sequences==
+{{main|Translational control sequence gene transcriptions}}
+"Maternal mRNAs are translationally regulated during early development. Zar1 and its closely related homolog, Zar2, are both crucial in early development. ''Xenopus laevis'' Zygote arrest 2 (Zar2) binds to the Translational Control Sequence (TCS) in maternal mRNAs and regulates translation."<ref name=Yamamoto>{{ cite journal
+|author=Tomomi M. Yamamoto, Jonathan M. Cook, Cassandra V. Kotter, Terry Khat, Kevin D. Silva, Michael Ferreyros, Justin W. Holt, Jefferson D. Knight, and Amanda Charlesworth
+|title=Zar1 represses translation in ''Xenopus'' oocytes and binds to the TCS in maternal mRNAs with different characteristics than Zar2
+|journal=Biochim Biophys Acta
+|date=October 2013
+|volume=1829
+|issue=10
+|pages=1034-46
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3810179/
+|arxiv=
+|bibcode=
+|doi=10.1016/j.bbagrm.2013.06.001
+|pmid=23827238
+|accessdate=19 April 2021 }}</ref>
-There is the following Inr in the core promoter, negative strand, negative direction: 5'-TTACTCC-3' at 4557.
+"Putative TCSs have been identified in Wee1, PCM-1 and Mos 3′ UTRs. The TCSs are slightly different: AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) [20]".<ref name=Yamamoto/>
-There are four Inrs in the core promoter, positive strand, negative direction: between 4425 and at 4542.
+==Unfolded protein response elements==
+{{main|Unfolded protein response element gene transcriptions}}
+X-box binding protein 1s "XBP1s binds to the [unfolded protein response] UPR element (UPRE) containing the consensus sequence TGACGTGG/A and regulates the transcription of target genes in a cell type- and condition-specific manner (Yamamoto et al., 2004)."<ref name=So/>
-There is the following Inr in the core promoter, negative strand, positive direction: 5'-CTGCACC-3' at 4343.
+The consensus sequence for UPRE is 5'-TGACGTG(G/A)-3'.<ref name=So/>
-There are two Inrs in the core promoter, positive strand, positive direction: 5'-CCACTCC-3' at 4401 and 5'-CCAGACC-3' at 4416.
+==Upstream stimulating factors==
+{{main|Upstream stimulatory factor gene transcriptions}}
-===Proximal promoters===
+"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."<ref name=Read/>
-There are eight Inrs on the negative strand in the negative direction: between 4202 and 4557.
+"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important ''cis''-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson ''et al.'', 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre ''et al.'', 1989)."<ref name=Read>{{ cite journal
+|author=Martin L. Read, Andrew R. Clark and Kevin Docherty
-There are seven Inrs on the positive strand in the negative direction: between 4327 and 4542.
+|title=The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer
+|journal=Biochemical Journal
+|date=1993
+|volume=295
+|issue=
+|pages=233-237
+|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1134844/pdf/biochemj00102-0234.pdf
+|arxiv=
+|bibcode=
+|doi=10.1042/bj2950233
+|pmid=8216223
+|accessdate=14 August 2020 }}</ref>
-There is one Inr on the negative strand in the positive direction: 5'-CTGCACC-3' at 4343.
+"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam ''et al.'', 1990a), is GCCACCGG."<ref name=Read/>
-There is two Inrs on the positive strand in the positive direction: 5'-CCACTCC-3' at 4401 and 5'-CCAGACC-3' at 4416.
+"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."<ref name=Read/>
-===Distal promoters===
+A likely general USF box consensus sequence may be 5'-GCC(A/T)NN(C/G/T)(A/G)-3'.
-Negative strand in the negative direction there are 87: between 71 and 4188.
+==V boxes==
+{{main|V box gene transcriptions}}
+"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu/>
-Positive strand in the negative direction there are 40: between 20 and 3967.
+In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.
-Inverse complement, negative strand, negative direction there are 32: between 213 and 3967.
+In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.
-Negative strand in the positive direction there are 45: between 115 and 4139.
+==Vitamin D response elements==
+{{main|Vitamin D response element gene transcriptions}}
+"Using the Jasper and Consite algorithms, the A/GGG/TTCAnnnA/GGG/TTCA and GA/GGTTCATnnnGTTCA sequences were considered as human and mouse VDRE consensus sequences, respectively, as previously shown.17, 18 Previous studies have suggested that regulatory VDREs could locate distally, i.e. > 1 Mb, to the transcription starting site.19 We analysed the entire genomic sequence of the human and murine ''HOTAIR'' and ''ANRIL'' genes as well as 5 kb upstream the transcription starting sites to include proximal promoter regions. Our analysis revealed two and three potential VDREs in the human ''HOTAIR'' and ''ANRIL'' genes, respectively, all of them were located within the intron 1 [...]."<ref name=Kakhki>{{ cite journal
+|author=Majid Pahlevan Kakhki, Abbas Nikravesh, Zeinab Shirvani Farsani, Mohammad Ali Sahraian, Mehrdad Behmanesh
+|title=''HOTAIR'' but not ''ANRIL'' long non‐coding RNA contributes to the pathogenesis of multiple sclerosis
+|journal=Immunology
+|date=April 2018
+|volume=153
+|issue=4
+|pages=479-487
+|url=https://onlinelibrary.wiley.com/doi/full/10.1111/imm.12850
+|arxiv=
+|bibcode=
+|doi=10.1111/imm.12850
+|pmid=
+|accessdate=8 March 2021 }}</ref>
-Positive strand in the positive direction there are 75: between 40 and 4136.
+==W boxes==
+{{main|W box gene transcriptions}}
-Inverse complement, negative strand, positive direction there are 61: between 53 and 4136.
+The "presence of WRKY TF binding sites (C/TTGACC/T, W boxes) in numerous co-regulated Arabidopsis defense gene promoters provided circumstantial evidence that zinc-finger-type WRKY factors play a broad and pivotal role in regulating defenses [10]."<ref name=Eulgem>{{ cite journal
+|author=Thomas Eulgem and Imre E Somssich
-Inverse complement, positive strand, negative direction there are 100: between 17 and 4177.
+|title=Networks of WRKY transcription factors in defense signaling
+|journal=Current Opinion in Plant Biology
+|date=2007
+|volume=10
+|issue=
+|pages=366–371
+|url=http://pubman.mpdl.mpg.de/pubman/item/escidoc:1221669/component/escidoc:1221668/eulgem_curr_op_plant_biol_2007.pdf
+|arxiv=
+|bibcode=
+|doi=10.1016/j.pbi.2007.04.020
+|pmid=
+|accessdate=17 October 2018 }}</ref>
-Inverse complement, positive strand, positive direction there are 75: between 524 and 4138.
+The W box is a DNA ''cis''-regulatory element sequence, (T)TGAC(C/T), which is recognized by the family of WRKY transcription factors.<ref name="pmid8541496">{{ cite journal|last=Rushton|first=Paul |author2=Macdonald, H. |author3=Huttly, A.K. |author4=Lazarus, C.M. |author5=Hooley, R|title=Members of a new family of DNA-binding proteins bind to a conserved ''cis''-element in the promoters of alpha-Amy2 genes|journal=Plant Molecular Biology|year=1995|volume=29|pages=691–702|pmid=8541496|doi=10.1007/bf00041160}}</ref><ref name="pmid20304701">{{cite journal |vauthors=Rushton PJ, Somssich IE, Ringler P, Shen QJ | title = WRKY transcription factors | journal = Trends Plant Science | volume = 15 | issue = 5 | pages = 247–58 |date=May 2010 | pmid = 20304701 | doi = 10.1016/j.tplants.2010.02.006 }}</ref>
-==Initiator elements (BBCABW)==
+==X core promoter elements==
-{{main|Initiator element gene transcriptions}}
+{{main|X core promoter element gene transcriptions}}
+"[T]he X gene core promoter element 1 ... is located between nucleotides -8 and +2 relative to the transcriptional start site (+1) and has a consensus sequence of G/A/T-G/C-G-T/C-G-G-G/A-A-G/C<sub>+1</sub>-A/C."<ref name=Tokusumi>{{ cite journal
+|author=Yumiko Tokusumi, Ying Ma, Xianzhou Song, Raymond H. Jacobson, and Shinako Takada
+|title=The New Core Promoter Element XCPE1 (X Core Promoter Element 1) Directs Activator-, Mediator-, and TATA-Binding Protein-Dependent but TFIID-Independent RNA Polymerase II Transcription from TATA-Less Promoters
+|journal=Molecular and Cellular Biology
+|date=March 2007
+|volume=27
+|issue=5
+|pages=1844-58
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1820453/
+|arxiv=
+|bibcode=
+|doi=10.1128/MCB.01363-06
+|pmid=17210644
+|accessdate=2013-02-09 }}</ref>
-===Core promoters===
+==Xenobiotic responsive elements==
+{{main|Xenobiotic responsive element gene transcriptions}}
+The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), contains the core sequence 5'-GCGTG-3'<ref name=Shen>{{cite journal | vauthors = Shen ES, Whitlock JP | title = Protein-DNA interactions at a dioxin-responsive enhancer. Mutational analysis of the DNA-binding site for the liganded Ah receptor | journal = The Journal of Biological Chemistry | volume = 267 | issue = 10 | pages = 6815–9 | date = April 1992 | pmid = 1313023 }}</ref> within the consensus sequence 5'-T/GNGCGTGA/CG/CA-3'<ref name=Lusska>{{cite journal | vauthors = Lusska A, Shen E, Whitlock JP | title = Protein-DNA interactions at a dioxin-responsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded Ah receptor | journal = The Journal of Biological Chemistry | volume = 268 | issue = 9 | pages = 6575–80 | date = March 1993 | pmid = 8384216 }}</ref><ref name=Yao/> in the [[Promoter (biology)|promoter region]] of AhR responsive genes. The AhR/ARNT heterodimer directly binds the AHRE/DRE/XRE core sequence in an asymmetric manner such that ARNT binds to 5'-GTG-3' and AhR binding 5'-TC/TGC-3'.<ref name=Wharton>{{cite journal | vauthors = Wharton KA, Franks RG, Kasai Y, Crews ST | title = Control of CNS midline transcription by asymmetric E-box-like elements: similarity to xenobiotic responsive regulation | journal = Development | volume = 120 | issue = 12 | pages = 3563–9 | date = December 1994 | pmid = 7821222 }}</ref><ref name=Bacsi>{{cite journal | vauthors = Bacsi SG, Reisz-Porszasz S, Hankinson O | title = Orientation of the heterodimeric aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence | journal = Molecular Pharmacology | volume = 47 | issue = 3 | pages = 432–8 | date = March 1995 | pmid = 7700240 }}</ref><ref name=Swanson>{{cite journal | vauthors = Swanson HI, Chan WK, Bradfield CA | title = DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins | journal = The Journal of Biological Chemistry | volume = 270 | issue = 44 | pages = 26292–302 | date = November 1995 | pmid = 7592839 | doi = 10.1074/jbc.270.44.26292 | doi-access = free }}</ref> Recent research suggests that a second type of element termed AHRE-II, 5'-CATG(N6)C[T/A]TG-3', is capable of indirectly acting with the AhR/ARNT complex.<ref name=Boutros>{{cite journal | vauthors = Boutros PC, Moffat ID, Franc MA, Tijet N, Tuomisto J, Pohjanvirta R, Okey AB | title = Dioxin-responsive AHRE-II gene battery: identification by phylogenetic footprinting | journal = Biochemical and Biophysical Research Communications | volume = 321 | issue = 3 | pages = 707–15 | date = August 2004 | pmid = 15358164 | doi = 10.1016/j.bbrc.2004.06.177 }}</ref><ref name=Sogawa>{{cite journal | vauthors = Sogawa K, Numayama-Tsuruta K, Takahashi T, Matsushita N, Miura C, Nikawa J, Gotoh O, Kikuchi Y, Fujii-Kuriyama Y | title = A novel induction mechanism of the rat CYP1A2 gene mediated by Ah receptor-Arnt heterodimer | journal = Biochemical and Biophysical Research Communications | volume = 318 | issue = 3 | pages = 746–55 | date = June 2004 | pmid = 15144902 | doi = 10.1016/j.bbrc.2004.04.090 }}</ref>
-There are five Inrs, positive strand, negative direction: between 4423 and 4531.
+==Yap recognition sequences==
+{{main|Yap1p,2p gene transcriptions}}
+"Saccharomyces cerevisiae contains eight members of a novel and fungus-specific family of bZIP proteins that is defined by four atypical residues on the DNA-binding surface. Two of these proteins, Yap1 and Yap2, are transcriptional activators involved in pleiotropic drug resistance. Although initially described as AP-1 factors, at least four Yap proteins bind most efficiently to TTACTAA, a sequence that differs at position ±2 from the optimal AP-1 site (TGACTCA); further, a Yap-like derivative of the AP-1 factor Gcn4 (A239Q S242F) binds efficiently to the Yap recognition sequence."<ref name=Fernandes>{{ cite journal
+|author=Lisete Fernandes, Claudina Rodrigues-Pousada, Kevin Struhl
+|title=Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions
+|journal=Molecular and Cellular Biology
+|date=December 1997
+|volume=17
+|issue=12
+|pages=6982-6993
+|url=https://mcb.asm.org/content/17/12/6982
+|arxiv=
+|bibcode=
+|doi=10.1128/MCB.17.12.6982
+|pmid=
+|accessdate=11 March 2021 }}</ref>
-There are five Inrs, negative strand, positive direction: between 4271 and 4338.
+The upstream activating sequence (UAS) for Yap1p/2p is TTACTAA, which is found in genes ''GSH1, TRX2, YCF1'', ''GLR1'', induced by oxidative stress such as H<sub>2</sub>O<sub>2</sub>, for regulation of genes expressed in response to environmental changes.<ref name=Tang/>
-There are four Inrs, positive strand, positive direction: between 4269 and 4414.
+==YY1==
+{{main|YY1 gene transcriptions}}
+YY1 consensus sequence is 5'-CCATTTA-3' and 5'-CCATCTT-3'.<ref name=Long2020/>
-===Proximal promoters===
+==Z boxes==
+{{main|Z box gene transcriptions}}
+"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of ''RbcS1A'' (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."<ref name=Song/>
-There are five Inrs on the negative strand in the negative direction: between 4200 and 4359.
+Z-boxes 1-3 contain 5'-AGGTG-3'.<ref name=Mejlvang>{{ cite journal
+|author=Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky
-There are nine Inrs on the positive strand in the negative direction: between 4233 and 4531.
+|title=Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition
+|journal=Molecular Biology of the Cell
-There is six Inrs on the negative strand in the positive direction: between 4195 and 4338.
+|date=November 2007
+|volume=18
-There is four Inrs on the positive strand in the positive direction: between 4269 and 4414.
+|issue=11
+|pages=4615–4624
-===Distal promoters===
+|url=https://www.molbiolcell.org/doi/pdf/10.1091/mbc.e07-05-0406
-Negative strand in the negative direction there are 44: between 179 and 3939.
-Positive strand in the negative direction there are 59: between 39 and 3965.
-Inverse complement, negative strand, negative direction there are 46: 5'-TCTGAC-3', 16: between 62 and 3983.
-Inverse complement, positive strand, negative direction there are 54, 5'-ACTGAA-3', 18: between 78 and 4093.
-Negative strand in the positive direction there 87: between 15 and 4013.
-Positive strand in the positive direction there are 40: between 153 and 4056.
-Inverse complement, negative strand, positive direction there are 94: between 54 and 4095.
-Inverse complement, positive strand, positive direction there are 47: between 236 and 4127.
-==Initiator-like element, TCT==
-{{main|Initiator element gene transcriptions}}
-Consensus sequence for an Inr-like/TCT is 5'-TTCTCT-3'.<ref name=Matsumoto/>
-Copying 5'-TTCTCT-3' in "⌘F" yields three between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
-==Jasmonic acid-responsive elements==
-{{main|Jasmonic acid-responsive element gene transcriptions}}
-Jasmonic acid-responsive elements (TGACG, CGTCA).<ref name=Sharma>{{ cite journal
-|author=Bhaskar Sharma & Joemar Taganna
-|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
-|journal=Scientific Reports
-|date=12 June 2020
-|volume=10
-|issue=9581
-|pages=
-|url=https://www.nature.com/articles/s41598-020-66553-1
-|arxiv=
-|bibcode=
-|doi=10.1038/s41598-020-66553-1
-|pmid=32533036
-|accessdate=27 August 2020 }}</ref>
-Copying an apparent consensus sequence for the jasmonic acid-responsive element (JARE)<ref name=Kim>{{ cite journal
-|author=Young Jin Kim, Dong Gwan Kim, Sun Hi Lee and Incheol Lee
-|title=Wound-induced expression of the ferulate 5-hydroxylase gene in ''Camptotheca acuminata''
-|journal=Biochimica et Biophysica Acta (BBA) - General Subjects
-|date=February 2006
-|volume=1760
-|issue=2
-|pages=182-190
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0304416505003351
-|arxiv=
-|bibcode=
-|doi=10.1016/j.bbagen.2005.08.015
-|pmid=16332414
-|accessdate=9 September 2020 }}</ref> of TGACG and putting it in "⌘F" finds eight located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Krüppel-like factors==
-{{main|Krüppel-like factor gene transcriptions}}
-"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."<ref name=Kulczynska>{{ cite journal
-|author=Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka
-|title=A ''Krüppel-like factor 1 (KLF1)'' Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity
-|journal=Molecular and Cellular Biology
-|date=12 February 2020
-|volume=40
-|issue=5
-|pages=e00444-19
-|url=
-|arxiv=
-|bibcode=
-|doi=10.1128/MCB.00444-19
-|pmid=31818881
-|accessdate=29 August 2020 }}</ref>
-"Using the ''in vitro'' CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."<ref name=Kulczynska/>
-An apparent consensus is GGG(A/C/G/T)(A/C/G/T)(G/T)(G/T)(G/T).
-Copying an apparent consensus sequence for the KLF of GGGTCGTG and putting it in "⌘F" finds six located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==M35 boxes==
-{{main|M35 box gene transcriptions}}
-Negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesM35--.bas, looking for 5'-TTGACA-3', 2, 5'-TTGACA-3', 477, 5'-TTGACA-3', 4399.
-==Metal responsive elements==
-{{main|Metal responsive element gene transcriptions}}
-===MRE proximal promoters===
-Positive strand, negative direction: 5'-TGCACTC-3' at 4341.
-===MRE distal promoters===
-Negative strand, negative direction: 5'-GAGTGCA-3', 1772, 5'-GTGTGCA-3', 531, and complements.
-Negative strand, positive direction: 5'-GGGTGCA-3' at 3883, 5'-TGCACCC-3' at 3323, 5'-TGCACAC-3' at 2963, 5'-GGGTGCA-3' at 2800, 5'-GAGTGCA-3' at 2326, 5'-GAGTGCA-3' at 1786, 5'-TGCGCCC-3' at 1657, 5'-GTGCGCA-3' at 1523, 5'-TGCGCCC-3' at 1499, 5'-TGCACTC-3' at 1473, 5'-TGCGCCC-3' at 1399, 5'-TGCACTC-3' at 1373, 5'-TGCGCCC-3' at 1247, 5'-TGCACAC-3' at 1221, 5'-GCGTGCA-3' at 1218, 5'-GGGCGCA-3' at 976, 5'-GGGCGCA-3' at 876, 5'-GCGCGCA-3' at 684, 5'-TGCACAC-3' at 549, 5'-GCGTGCA-3' at 546, 5'-TGCGCCC-3' at 453, and complements.
-Positive strand, negative direction: 5'-TGCACTC-3' at 3290, 5'-GTGTGCA-3' at 2863, 5'-TGCACCC-3' at 2762, 5'-TGCACTC-3' at 2427, 5'-TGCACTC-3' at 2001, 5'-GAGTGCA-3' at 1470, 5'-TGCACTC-3' at 1348, 5'-TGCGCTC-3' at 891, and complements.
-Positive strand, positive direction: 5'-TGCGCCC-3' at 972, 5'-TGCGCCC-3' at 872, and complements.
-==Mig1ps==
-{{main|Mig1p gene transcriptions}}
-The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or 5'-(C/G)(C/T)GGGG-3'.<ref name=Tang/>
-Copying 5'-CTGGGG-3' in "⌘F" yields none between ZSCAN22 and A1BG and four between ZNF497 and A1BG as can be found by the computer programs.
-==Msn2,4p==
-{{main|Msn2,4p gene transcriptions}}
-The upstream activating sequence (UAS) for the Msn2,4p transcription factor is 5'-CCCCT-3'.<ref name=Tang/>
-Copying 5'-CCCCT-3' in "⌘F" yields one between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
-==MYB recognition elements==
-{{main|MYB recognition element gene transcriptions}}
-"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."<ref name=Rushton>{{ cite journal
-|author=Paul J Rushton and Imre E Somssich
-|title=Transcriptional control of plant genes responsive to pathogens
-|journal=Current Opinion in Plant Biology
-|date=August 1998
-|volume=1
-|issue=4
-|pages=311-5
-|url=http://arquivo.ufv.br/dbv/pgfvg/bve684/htms/pdfs_revisao/estresse/transcriptional.pdf
-|arxiv=
-|bibcode=
-|doi=10.1016/1369-5266(88)80052-9
-|pmid=10066598
-|accessdate=5 November 2018 }}</ref>
-MYB binding site involved in drought induction (TAACTG).<ref name=Sharma/>
-Copying an apparent core consensus sequence for the MYBRE of AACAAAC or TAACTG and putting it in "⌘F" finds none located between ZSCAN22 and none or one between ZNF497 and A1BG as can be found by the computer programs.
-==Myocyte enhancer factor 2 (MEF2)==
-{{main|Myocyte enhancer factor gene transcriptions}}
-Myocyte enhancer factor-2 (MEF2) [[protein]]s are a family of [[transcription factor]]s which through control of [[gene expression]] are important regulators of [[cellular differentiation]] and consequently play a critical role in embryonic development.<ref name="pmid17959722">{{ cite journal |vauthors=Potthoff MJ, Olson EN | title = MEF2: a central regulator of diverse developmental programs | journal = Development | volume = 134 | issue = 23 | pages = 4131–40 |date=December 2007 | pmid = 17959722
-| doi = 10.1242/dev.008367
-| url =  }}</ref>  In adult organisms, Mef2 proteins mediate the stress response in some tissues.<ref name="pmid17959722"/>
-"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."<ref name=Zia>{{ cite journal
-|author=Ayisha Zia, Muhammad Imran, and Sajid Rashid
-|title=In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity
-|journal=Journal of Chemical Information and Modeling
-|date=7 February 2020
-|volume=60
-|issue=3
-|pages=1892-1909
-|url=https://pubs.acs.org/doi/abs/10.1021/acs.jcim.0c00008
-|arxiv=
-|bibcode=
-|doi=10.1021/acs.jcim.0c00008
-|pmid=
-|accessdate=10 September 2020 }}</ref> Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).<ref name=Zia/>
-Copying an apparent consensus sequence for the TTATATATA or CTAATTTTAA and putting it in "⌘F" finds none (TTATATATA) located between ZSCAN22 and one (CTAATTTTAA) between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor kappa-light-chain-enhancer of activated B cells==
-{{main|Nuclear factor gene transcriptions}}
-The "natural 11 bp 𝜿B binding site MHC H-2 [is 5'-CCCCTAAGGGG-3'] which is well ordered in our structure."<ref name=Cramer>{{ cite journal
-|author=Patrick Cramer, Christopher J. Larson, Gregory L. Verdine and Christoph W. Müller
-|title=Structure of the human NF‐κB p52 homodimer‐DNA complex at 2.1 Å resolution
-|journal=The EMBO Journal
-|date=1 December 1997
-|volume=16
-|issue=23
-|pages=7078-90
-|url=https://www.embopress.org/doi/10.1093/emboj/16.23.7078
-|arxiv=
-|bibcode=
-|doi=10.1093/emboj/16.23.7078
-|pmid=9384586
-|accessdate=3 May 2020 }}</ref>
-Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC).<ref name=Sato/>
-Copying an apparent core consensus sequence for the NF𝛋B of GAATTC and putting it in "⌘F" finds three cores located between ZSCAN22 and none between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor of activated T cell transcriptions==
-{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)}}
-Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).<sup>3</sup>"<ref name=Jain>{{ cite journal
-|author=Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao
-|title=A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region
-|journal=Journal of Biological Chemistry
-|date=24 February 1995
-|volume=270
-|issue=8
-|pages=4138-4145
-|url=https://www.jbc.org/content/270/8/4138.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1074/jbc.270.8.4138
-|pmid=7876165
-|accessdate=15 August 2020 }}</ref>
-Copying an apparent consensus sequence for the NFAT GGAAAA and putting it in "⌘F" finds none located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor 1==
-{{main|Nuclear factor gene transcriptions}}
-Nuclear factor 1 (NF-1) is a family of closely related [[transcription factor]]s that constitutively bind as dimers to specific sequences of DNA with high affinity.<ref name=Blomquist>{{ cite journal
-|vauthors=Blomquist P, Belikov S, Wrange O
-|title=Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure
-|journal=Nucleic Acids Research
-|volume=27
-|issue=2
-|pages=517–25
-|date=January 1999
-|pmid=9862974
-|pmc=148209
-|doi= 10.1093/nar/27.2.517
-|url= }}</ref> Family members contain an unusual [[DNA binding domain]] that binds to the [[recognition sequence]] 5'-TTGGCXXXXXGCCAA-3'.<ref name=Boron>{{ cite book
-|author=Walter F. Boron
-|title=Medical Physiology: A Cellular And Molecular Approach
-|publisher=Elsevier/Saunders
-|location=
-|year=2003
-|pages=125–126
-|isbn=1-4160-2328-3
-|oclc=
-|doi= }}</ref>
-Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.<ref name=Yao2016/>
-An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).
-Copying an apparent consensus sequence for the NF1 TGGCA and putting it in "⌘F" finds none located between ZSCAN22 and five between ZNF497 and A1BG as can be found by the computer programs.
-==ORE1 binding sites==
-{{main|ORE1 binding site gene transcriptions}}
-"As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [37]."<ref name=Qiu/>
-Consensus sequences are 5'-(A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G)-3' or 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.<ref name=Qiu/>
-Copying 5'-TTACGTG-3' in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-Copying 5'-TGACGTGAG-3' in "⌘F" yields three between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-Copying 5'-TAGCGT-3' in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-Copying 5'-TAACGTGAG-3' in "⌘F" yields two between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==p53 response elements==
-{{main|P53 response element gene transcriptions}}
-"A p53 consensus DNA RE is composed of a tandem of two decameric palindromic sequences (half-sites) 5′-RRRCWWGYYY-3′, where R = purine, Y = pyrimidine and W is either A or T. There is a variability in composition of p53 REs, thus two half-sites can be separated by a spacer DNA, typically 0–13 bp in length and many p53 DNA REs have varying numbers of half-sites (19,20,22,33–37)."<ref name=Kearns>{{ cite journal
-|author=Sinéad Kearns, Rudi Lurz, Elena V. Orlova, Andrei L. Okorokov
-|title=Two p53 tetramers bind one consensus DNA response element
-|journal=Nucleic Acid Research
-|date=27 July 2016
-|volume=44
-|issue=13
-|pages=6185–6199
-|url=https://academic.oup.com/nar/article/44/13/6185/2457565
-|arxiv=
-|bibcode=
-|doi=10.1093/nar/gkw215
-|pmid=
-|accessdate=6 October 2020 }}</ref>
-Positive strand in the negative direction using SuccessablesPRE+-.bas, looking for 5'-(A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T)-3', found 3: 5'-AGGCAAGCCT-3' at 457, 5'-AGACTTGCCT-3' at 1621, and 5'-AGACAAGCTT-3' at 4186, and their complements with the transcription start site at 4460 from ZSCAN22 toward A1BG.
-==p63 DNA-binding sites==
-{{main|P63 DNA-binding site gene transcriptions}}
-"p63 bound preferentially to DNA fragments conforming to the 20 bp sequence 5'-RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY-3'."<ref name=Perez>{{ cite journal
-|author=C A Perez, J Ott, D J Mays & J A Pietenpol
-|title=p63 consensus DNA-binding site: identification, analysis and application into a p63MH algorithm
-|journal=Oncogene
-|date=15 November 2007
-|volume=26
-|issue=52
-|pages=7363-70
-|url=https://pubmed.ncbi.nlm.nih.gov/17563751/
-|arxiv=
-|bibcode=
-|doi=10.1038/sj.onc.1210561
-|pmid=17563751
-|accessdate=28 August 2020 }}</ref>
-The apparent consensus sequence is (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T).
-Copying an apparent consensus sequence for the P63 (GAGCGAGCCT) and putting it in "⌘F" finds none located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
-==P boxes==
-{{main|P box gene transcriptions}}
-"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu>{{ cite journal
-|author=Wangjie Yu and Paul E. Hardin
-|title=Circadian oscillators of ''Drosophila'' and mammals
-|journal=Journal of Cell Science
-|date=2006
-|volume=119
-|issue=
-|pages=4793-5
-|url=http://jcs.biologists.org/content/119/23/4793.short
-|arxiv=
-|bibcode=
-|doi=10.1242/jcs.03174
-|pmid=17130292
-|accessdate=2017-02-19 }}</ref>
-Copying the apparent consensus sequence for the P box (GTAA(T/C)) and putting it in "⌘F" finds seven located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
-Negative strand in the negative direction (from ZSCAN22 to A1BG) using SuccessablesPbox--.bas, looking for 5'-(A/G)T(A/T)(A/T)(T/C)-3' found 84.
-==Peroxisome proliferator hormone response elements==
-{{main|Peroxisome proliferator hormone response element gene transcriptions}}
-"After activation by ligands, PPARs/RXRs heterodimers bind to PPRE consensus sequence (AGGTCANAGGTCA) in the promoter of their target genes."<ref name=You>{{ cite journal
-|author=Mengli You, Shuping Yuan, Juanjuan Shi, Yongzhong Hou
-|title=PPARδ signaling regulates colorectal cancer
-|journal=Current Pharmaceutical Design
-|date=1 June 2015
-|volume=21
-|issue=21
-|pages=2956-2959
-|url=https://www.ingentaconnect.com/content/ben/cpd/2015/00000021/00000021/art00006#expand/collapse
-|arxiv=
-|bibcode=
-|doi=10.2174/1381612821666150514104035
-|pmid=26004416
-|accessdate=10 September 2020 }}</ref>
-The DNA consensus sequence is AGGTCANAGGTCA, with N being any nucleotide.
-Peroxisome proliferator hormone response elements (PPREs) consensus sequences are AGGGGA and TCCCCT.<ref name=Yao>{{ cite journal
-| vauthors = Yao EF, Denison MS
-| title = DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer
-| journal = Biochemistry
-| volume = 31
-| issue = 21
-| pages = 5060–7
-| date = June 1992
-| pmid = 1318077
-| doi = 10.1021/bi00136a019 }}</ref>
-Copying the apparent consensus sequence for the PPRE (AGGGGA) and putting it in "⌘F" finds none located between ZSCAN22 or three between ZNF497 and A1BG as can be found by the computer programs.
-==Phosphate starvation-response transcription factors==
-{{main|Phosphate starvation-response transcription factor gene transcriptions}}
-"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
-|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
-|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
-|journal=Genome Research
-|date=21 March 2018
-|volume=28
-|issue=
-|pages=497-508
-|url=https://genome.cshlp.org/content/28/4/497.full
-|arxiv=
-|bibcode=
-|doi=10.1101/gr.229518.117
-|pmid=29563167
-|accessdate=31 August 2020 }}</ref>
-The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.<ref name=Shao/>
-Copying the apparent consensus sequence for the Pho (CACGTG) and putting it in "⌘F" finds none located between ZSCAN22 or one between ZNF497 and A1BG as can be found by the computer programs.
-==Pollen1 elements==
-{{main|Pollen1 element gene transcriptions}}
-"Electrophoretic mobility shift assays identified a pollen-specific ''cis''-acting element POLLEN1 (AGAAA) mapped at ''AtACBP4'' (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."<ref name=Ye/>
-"Given that ''AtACBP4pro::GUS'' (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 ''cis''-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."<ref name=Ye/>
-"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato ''LAT52'' (Bate and Twell 1998)."<ref name=Ye/>
-Copying the consensus for POLLEN1: 5'-AGAAA-3' and putting the sequence in "⌘F" finds many locations for this sequence in the A1BG directions as can be found by the computer programs.
-==Pribnow boxes==
-{{main|Pribnow box gene transcriptions}}
-# negative strand in the negative direction, looking for 5'-TATAAT-3', 2, 5'-TATAAT-3', 3454, 5'-TATAAT-3', 3468,
-# negative strand in the positive direction, looking for 5'-TATAAT-3', 1, 5'-TATAAT-3', 729,
-# complement, positive strand, negative direction, looking for 5'-ATATTA-3', 2, 5'-ATATTA-3', 3454, 5'-ATATTA-3', 3468,
-# complement, positive strand, positive direction, looking for 5'-ATATTA-3', 1, 5'-ATATTA-3', 729,
-# inverse complement, negative strand, negative direction, looking for 5'-ATTATA-3', 2, 5'-ATTATA-3', 272, 5'-ATTATA-3', 603,
-# inverse complement, negative strand, positive direction, looking for 5'-ATTATA-3', 1, 5'-ATTATA-3', 727,
-# inverse, positive strand, negative direction, looking for 5'-TAATAT-3', 2, 5'-TAATAT-3', 272, 5'-TAATAT-3', 603,
-# inverse, positive strand, positive direction, looking for 5'-TAATAT-3', 1, 5'-TAATAT-3', 727.
-==Prolamin boxes==
-{{main|Prolamin box gene transcriptions}}
-# negative strand in the negative direction: 1, 5'-TGTAAAG-3', 2884,
-# negative strand in the positive direction: 1, 5'-TGAAAAG-3', 489,
-# positive strand in the negative direction: 1, 5'-TGAAAAG-3', 1627.
-==Pyrimidine boxes==
-{{main|Pyrimidine box gene transcriptions}}
-Pyrimidine boxes and their complements in the negative direction: 5'-CCTTTT-3' at 2459, 5'-CCTTTT-3' at 2927, and 5'-CCTTTT-3' at 2968 occur. Inverse pyrimidine boxes and their complements occur 5'-AAAAGG-3' at 105, 5'-AAAAGG-3' at 1107, 5'-AAAAGG-3' at 3345, and 5'-AAAAGG-3' at 3441.
-Pyrimidine boxes in the positive direction: 5'-CCTTTT-3' at 135 and 5'-CCTTTT-3' at 291 and their complements are close to ZNF497.
-==Q elements==
-{{main|Q element gene transcriptions}}
-"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."<ref name=Ye>{{ cite journal
-|author=Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye
-|title=Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism
-|journal=Plant Molecular Biology
-|date=January 2017
-|volume=93
-|issue=
-|pages=209-225
-|url=https://www.researchgate.net/profile/Jianxin_Shi6/publication/309799453_Kelch-motif_containing_acyl-CoA_binding_proteins_AtACBP4_and_AtACBP5_are_differentially_expressed_and_function_in_floral_lipid_metabolism/links/5d11201c458515c11cf5f6b1/Kelch-motif-containing-acyl-CoA-binding-proteins-AtACBP4-and-AtACBP5-are-differentially-expressed-and-function-in-floral-lipid-metabolism.pdf
-|arxiv=
-|bibcode=
-|doi=10.1007/s11103-016-0557-5
-|pmid=27826761
-|accessdate=7 May 2020 }}</ref>
-The consensus sequence for a Q element is 5'-AGGTCA-3'.<ref name=Ye/>
-Copying the apparent consensus sequence for the QE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 or three between ZNF497 and A1BG as can be found by the computer programs.
-==Rap1 regulatory factors==
-{{main|Rap1 regulatory factor gene transcriptions}}
-Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).<ref name=Rossi/>
-"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."<ref name=Rossi/>
-Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.
-==Reb1 general regulatory factors==
-{{main|Reb1 general regulatory factor gene transcriptions}}
-Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
-Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.
-==Retinoblastoma control elements==
-{{main|TC element gene transcriptions}}
-"Robbins ''et al.'' (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-''fos'' and have identified an element, termed the retinoblastoma control element (RCE), in the c-''fos'' promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-''β''1, -''β''2, and -''β''3 promoters by Kim ''et al.'' (19)."<ref name=Pietenpol>{{ cite journal
-|author=Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses
-|title=Factor-binding element in the human c-''myc'' promoter involved in transcriptional regulation by transforming growth factor ''β''1 and by the retinoblastoma gene product
-|journal=Proceedings of the National Academy of Sciences USA
-|date=November 15, 1991
-|volume=88
-|issue=22
-|pages=10227-10231
-|url=http://www.pnas.org/content/pnas/88/22/10227.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.88.22.10227
-|pmid=1946442
-|accessdate=5 December 2018 }}</ref>
-"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."<ref name=Sato>{{ cite journal
-|author=Hiroshi Sato, Megumi Kita, and Motoharu Seiki
-|title=v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements
-|journal=The Journal of Biological Chemistry
-|date=5 November 1993
-|volume=268
-|issue=31
-|pages=23460-8
-|url=https://www.jbc.org/content/268/31/23460.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=8226872
-|accessdate=13 August 2020 }}</ref>
-"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-''O''-tetradecanoylphorbol-13-acetate (TPA) (15-20)."<ref name=Sato/>
-Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."<ref name=Sato/>
-Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-''O''-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).<ref name=Sato/>
-"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human ''PAI-1'' gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."<ref name=Motojima>{{ cite journal
-|author=Masaru Motojima, Takao Ando and Toshimasa Yoshioka
-|title=Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (''PAI-1'') gene expression in mesangial cells
-|journal=Biomedical Journal
-|date=10 July 2000
-|volume=349
-|issue=2
-|pages=435-441
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1221166/pdf/10880342.pdf
-|arxiv=
-|bibcode=
-|doi=10.1042/0264-6021:3490435
-|pmid=10880342
-|accessdate=13 August 2020 }}</ref>
-"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."<ref name=Motojima/>
-D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).<ref name=Motojima/>
-Copying the apparent consensus sequence for the RCE, GT box, (GGGGTGGGG) and putting it in "⌘F" finds none located between ZSCAN22 or between ZNF497 and A1BG as can be found by the computer programs. However, RCE (GGGGAGGGG) finds none located between ZSCAN22 and one between ZNF497 and A1BG.
-==Retinoic acid response elements==
-{{main|Retinoic acid response element gene transcriptions}}
-Retinoic acid response elements (RAREs).
-"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."<ref name=Kumar>{{ cite journal
-|author=Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq
-|title=A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome
-|journal=Frontiers in Human Neuroscience
-|date=9 August 2016
-|volume=10
-|issue=
-|pages=403
-|url=https://www.frontiersin.org/articles/10.3389/fnhum.2016.00403/full
-|arxiv=
-|bibcode=
-|doi=10.3389/fnhum.2016.00403
-|pmid=27555815
-|accessdate=7 September 2020 }}</ref>
-"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."<ref name=Gu>{{ cite journal
-|author=Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang
-|title=Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region
-|journal=Pediatric Research
-|date=July 2016
-|volume=80
-|issue=1
-|pages=159-168
-|url=https://www.nature.com/articles/pr201647
-|arxiv=
-|bibcode=
-|doi=10.1038/pr.2016.47
-|pmid=26991262
-|accessdate=7 September 2020 }}</ref>
-"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, [[Complex locus A1BG and ZNF497#Vitamin D response elements|vitamin D receptors]] (VDR) and [[Complex locus A1BG and ZNF497#Peroxisome proliferator hormone response elements|peroxisome proliferator-activated receptors]] (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."<ref name=Gu/>
-Additional response elements that include the 5'-AGGTCA-3' are [[Complex locus A1BG and ZNF497#Q elements|Q elements]], [[Complex locus A1BG and ZNF497#ROR-response elements|ROR-response elements]] and [[Complex locus A1BG and ZNF497#Thyroid hormone response elements|Thyroid hormone response elements]].
-A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.<ref name=Gu/>
-Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
-==Root specific elements==
-{{main|Root specific element gene transcriptions}}
-Root specific elements (TGACGTCA).<ref name=Sharma/>
-Copying the apparent consensus sequence for the RSE (TGACGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==ROR-response elements==
-{{main|ROR-response element gene transcriptions}}
-RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)<sup>13, 31</sup>."<ref name=Wang2016>{{ cite journal
-|author=Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen
-|title=ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
-|journal=Nature Medicine
-|date=May 2016
-|volume=22
-|issue=5
-|pages=488-496
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5030109/
-|arxiv=
-|bibcode=
-|doi=10.1038/nm.4070
-|pmid=27019329
-|accessdate=6 September 2020 }}</ref>
-Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==R response elements==
-{{main|MYB recognition element gene transcriptions}}
-The consensus sequence for the RRE is 5'-CATCTG-3'.<ref name=Hartmann>{{ cite journal
-|author=Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar
-|title=Differential combinatorial interactions of ''cis''-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes
-|journal=Plant Molecular Biology
-|date=January 2005
-|volume=57
-|issue=2
-|pages=155–171
-|url=http://pubman.mpdl.mpg.de/pubman/item/escidoc:1222162/component/escidoc:1222161/hartmann_weisshaar_pmb_2005.pdf
-|arxiv=
-|bibcode=
-|doi=10.1007/s11103-004-6910-0
-|pmid=15821875
-|accessdate=10 November 2018 }}</ref>
-Copying the apparent consensus sequence for the RRE (CATCTG) and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Serum response elements==
-{{main|CArG box gene transcriptions}}
-{{main|Enhancer box gene transcriptions}}
-{{main|Serum response element gene transcriptions}}
-The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
-|author=Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg
-|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
-|journal=The Journal of Biological Chemistry
-|date=14 October 1994
-|volume=269
-|issue=41
-|pages=25483-25493
-|url=http://www.jbc.org/content/269/41/25483.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=7929249
-|accessdate=7 December 2019 }}</ref>
-'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.
-'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.
-'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".
-'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.
-==Servenius sequences==
-{{main|Servenius sequence gene transcriptions}}
-The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."<ref name=Cogswell>{{ cite journal
-|author=John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting
-|title=X-box-binding proteins positively and negatively regulate transcription of the ''HLA-DRA'' gene through interaction with discrete upstream W and V elements
-|journal=Proceedings of the National Academy of Sciences USA
-|date=October 1990
-|volume=87
-|issue=19
-|pages=7703-7707
-|url=https://www.pnas.org/content/pnas/87/19/7703.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.87.19.7703
-|pmid=2120707
-|accessdate=20 August 2020 }}</ref>
-Copying the apparent consensus sequence for Servenius (GGACCCT) and putting it in "⌘F" finds three located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Specificity proteins==
-{{main|Specificity protein gene transcriptions}}
-{{main|Sp1 gene transcriptions}}
-Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).<ref name=Motojima/>
-"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."<ref name=Motojima/>
-Sp-1 (CCGCCCC).<ref name=Sato/>
-Sp1 (GCGGC).<ref name=Yao2016>{{ cite journal
-|author=D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor
-|title=Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid
-|journal=Journal of Dairy Science
-|date=May 2016
-|volume=99
-|issue=5
-|pages=3945-3957
-|url=https://www.sciencedirect.com/science/article/pii/S0022030216300273
-|arxiv=
-|bibcode=
-|doi=10.3168/jds.2015-10601
-|pmid=26947306
-|accessdate=5 September 2020 }}</ref>
-An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 5'-(C/G)(C/G/T)G(C/G)C(C/T)-3'. Or, each must be considered separately.
-Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.
-==STATs==
-{{main|STAT gene transcriptions}}
-A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.<sup>(37–40)</sup>"<ref name=Ghislain>{{ cite journal
-|author=Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish
-|title=The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds ''In Vitro'' to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes
-|journal=Journal of Interferon and Cytokine Research
-|date=June 2001
-|volume=21
-|issue=6
-|pages=379-388
-|url=https://www.researchgate.net/profile/Thomas_Wong29/publication/11899907_The_Interferon-Inducible_Stat2Stat1_Heterodimer_Preferentially_Binds_In_Vitro_to_a_Consensus_Element_Found_in_the_Promoters_of_a_Subset_of_Interferon-Stimulated_Genes/links/5ade147aaca272fdaf88c226/The-Interferon-Inducible-Stat2Stat1-Heterodimer-Preferentially-Binds-In-Vitro-to-a-Consensus-Element-Found-in-the-Promoters-of-a-Subset-of-Interferon-Stimulated-Genes.pdf
-|arxiv=
-|bibcode=
-|doi=10.1089/107999001750277
-|pmid=11440635
-|accessdate=15 August 2020 }}</ref> Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.<ref name=Ghislain/>
-"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."<ref name=Wesoly>{{ cite journal
-|author=Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen
-|title=STAT activation and differential complex formation dictate selectivity of interferon responses
-|journal=Acta Biochimica Polonica
-|date=31 March 2007
-|volume=54
-|issue=1
-|pages=27-38
-|url=https://ojs.ptbioch.edu.pl/index.php/abp/article/download/3266/2324
-|arxiv=
-|bibcode=
-|doi=10.18388/abp.2007_3266
-|pmid=17351669
-|accessdate=15 August 2020 }}</ref>
-===Proximal promoters===
-Negative strand in the positive direction there is 1: 5'-TTCCGGGAA-3', 4247.
-===Distal promoters===
-Positive strand in the negative direction there are 2: 5'-TTCGTTGAA-3', 3506, 5'-TTCCCTGAA-3', 3782.
-Positive strand in the positive direction there is 1: 5'-TTCCATGAA-3', 128.
-==Ste12p==
-{{main|Ste12p gene transcriptions}}
-The upstream activating sequence (UAS) for Ste12p is 5'-TGAAAC-3'.<ref name=Tang/>
-Copying 5'-TGAAAC-3' in "⌘F" yields eleven between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Synaptic Activity-Responsive Elements==
-{{main|Synaptic Activity-Responsive Elements}}
-"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."<ref name=Tornos>{{ cite journal
-|author=Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto
-|title=Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF
-|journal=PLoS ONE
-|date=31 January 2013
-|volume=8
-|issue=1
-|pages=e53848
-|url=https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0053848&type=printable
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pone.0053848
-|pmid=23382855
-|accessdate=12 November 2018 }}</ref>
-"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."<ref name=Montminy/>
-The consensus sequence for the myocyte enhancer factor 2 (MEF2) is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).<ref name=Zia/>
-The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra/>
-Copying each of the consensus sequences and putting the sequence in "⌘F" or from running the computer programs finds one MEF2 (CTAATTTTAA) between ZNF497 and A1BG or 5'-TGACGTCA-3' at 4317 between ZSCAN22 and A1BG, 5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG, TTAGGACAT is a C/EBP box that does not occur in either promoter, as can be found by the computer programs.
-==TACTAAC boxes==
-{{main|TACTAAC box gene transcriptions}}
-"A consensus sequence TACTAA(C/T) was derived for the branch site of ''Dictyostelium'' introns."<ref name=Rivero>{{ cite journal
-|author=Francisco Rivero
-|title=mRNA processing in Dictyostelium: sequence requirements for termination and splicing
-|journal=Protist
-|month=June
-|year=2002
-|volume=153
-|issue=2
-|pages=169-76
-|url=http://www.academia.edu/download/45750040/1434-4610-0009520160518-7945-1y17rxg.pdf
-|arxiv=
-|bibcode=
-|doi=10.1078/1434-4610-00095
-|pmid=12125758
-|accessdate=2017-04-05 }}</ref>
-# positive strand in the positive direction is SuccessablesTACT++.bas, looking for 5'-TACTAA(C/T)-3', 1, 5'-TACTAAT-3', 718,
-# complement, negative strand, positive direction is SuccessablesTACTc-+.bas, looking for 5'-ATGATT(A/G)-3', 1, 5'-ATGATTA-3', 718,
-# inverse complement, positive strand, positive direction is SuccessablesTACTci++.bas, looking for 5'-(A/G)TTAGTA-3', 1, 5'-ATTAGTA-3', 709,
-# inverse, negative strand, positive direction, is SuccessablesTACTi-+.bas, looking for 5'-(C/T)AATCAT-3', 1, 5'-TAATCAT-3', 709.
-==TAGteams==
-{{main|TAGteam gene transcriptions}}
-The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."<ref name=Fonseca>{{ cite journal
-|author=Rodrigo Nunes da Fonseca and Thiago M. Venancio
-|title=Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda
-|journal=Plos Genetics
-|date=1 March 2018
-|volume=14
-|issue=3
-|pages=e1007201
-|url=https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007201
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pgen.1007201
-|pmid=29494591
-|accessdate=5 September 2020 }}</ref>
-Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.
-==Tapetum boxes==
-{{main|Tapetum box gene transcriptions}}
-The consensus sequence for the TAPETUM box is TCGTGT.<ref name=Ye/>
-Copying the consensus Tapetum box: 5'-TCGTGT-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG and one between ZSCAN22 and A1BG as can be found by the computer programs.
-==TATA boxes==
-{{main|TATA box gene transcriptions}}
-Negative strand in the negative direction there are 2: 5'-TATATATA-3' at 1600 (or -2860 nts upstream from the TSS) and 5'-TATATAAA-3' at 1602 (or -2858 nts).
-Positive strand in the negative direction there are 3: 5'-TATAAAAG-3' at 184 (or -4276 nts), 5'-TATAAAAG-3' at 223 (or -4237 nts), and 5'-TATATAAA-3' at 2874 (or -1586 nts).
-Inverse complement, negative strand, negative direction there are 2: 5'-TATATATA-3', 1600, 5'-TTTATATA-3', 2871.
-Inverse complement, positive strand, negative direction there is 1: 5'-TTTTTATA-3', 219.
-==TAT boxes==
-{{main|TAT box gene transcriptions}}
-Only an inverse and its complement occurs between ZSCAN22 and A1BG: 5'-TACCTAT-3' at 2996 nts from ZSCAN22.
-==T boxes==
-{{main|T box gene transcriptions}}
-"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."<ref name=Conlon>{{ cite journal
-|author=Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith
-|title=Determinants of T box protein specificity
-|journal=Development
-|date=2001
-|volume=128
-|issue=19
-|pages=3749-3758
-|url=http://dev.biologists.org/content/develop/128/19/3749.full.pdf?download=true
-|arxiv=
-|bibcode=
-|doi=
-|pmid=11585801
-|accessdate=17 November 2018 }}</ref>
-"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."<ref name=Zhang2014/>
-"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."<ref name=Liu>{{ cite journal
-|author=Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko
-|title=Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites
-|journal=Proceedings of the National Academy of Sciences of the USA
-|date=25 October 2016
-|volume=113
-|issue=43
-|pages=E6572-E6581
-|url=https://www.pnas.org/content/113/43/E6572
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.1613914113
-|pmid=27791029
-|accessdate=28 August 2020 }}</ref>
-Copying the consensus T boxes: 5'-TCACACCT-3' or 5'-AACGTT-3' and putting the sequence in "⌘F" finds two locations or zero for these sequences respectively between ZSCAN22 or ZNF497 and A1BG as can be found by the computer programs.
-==Telomeric repeat DNA-binding factors==
-{{main|Telomeric repeat DNA-binding factor gene transcriptions}}
-Copying the consensus telomeric repeat DNA-binding factor (TRF): 5'-TTAGGG-3' and putting the sequence in "⌘F" locates ten of this sequence between ZSCAN22 and A1BG in the negative direction and two nucleotides between ZNF497 and A1BG as can be found by the computer programs.
-In the nucleotides between ZSCAN22 and A1BG there is are ten 5'-TTAGGG-3' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.
-''Homo sapiens'' genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".<ref name=Maru>{{ cite book
-|author=Yoshiro Maru
-|title=Basic Research, In: "Inflammation and Metastasis"
-|publisher=Springer
-|location=Tokyo
-|date=2016
-|editor=
-|pages=193-231
-|url=https://link.springer.com/chapter/10.1007/978-4-431-56024-1_10
-|arxiv=
-|bibcode=
-|doi=10.1007/978-4-431-56024-1_10
-|pmid=
-|isbn=978-4-431-56022-7
-|accessdate=28 August 2020 }}</ref>
-==Thyroid hormone response elements==
-{{main|Thyroid hormone response element gene transcriptions}}
-"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."<ref name=Pinto>{{ cite journal
-|author=Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford
-|title=Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation
-|journal=Endocrinology
-|date=1 September 2017
-|volume=158
-|issue=9
-|pages=3067-3078
-|url=https://academic.oup.com/endo/article/158/9/3067/3979086
-|arxiv=
-|bibcode=
-|doi=10.1210/en.2017-00314
-|pmid=28911178
-|accessdate=5 September 2020 }}</ref>
-Copying the consensus sequence for the TRE: 5'-AGGTCA-3' and putting the sequence in "⌘F" finds no locations between ZNF497 and A1BG or two locations between ZSCAN22 and A1BG as can be found by the computer programs.
-==Upstream stimulating factors==
-{{main|Upstream stimulatory factor gene transcriptions}}
-"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."<ref name=Read/>
-"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important ''cis''-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson ''et al.'', 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre ''et al.'', 1989)."<ref name=Read>{{ cite journal
-|author=Martin L. Read, Andrew R. Clark and Kevin Docherty
-|title=The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer
-|journal=Biochemical Journal
-|date=1993
-|volume=295
-|issue=
-|pages=233-237
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1134844/pdf/biochemj00102-0234.pdf
-|arxiv=
-|bibcode=
-|doi=10.1042/bj2950233
-|pmid=8216223
-|accessdate=14 August 2020 }}</ref>
-"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam ''et al.'', 1990a), is GCCACCGG."<ref name=Read/>
-"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."<ref name=Read/>
-A likely general USF box consensus sequence may be 5'-GCC(A/T)NN(C/G/T)(A/G)-3'.
-===Those containing an E-box (CANNTG)===
-# Negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesUSFbox-+.bas, looking for 5'-GCC(A/T)NN(C/G/T)(A/G)-3': 1, 5'-GCCACATG-3' at 3707.
-# inverse complement, positive strand, negative direction is SuccessablesUSFboxci+-.bas, looking for 5'-(C/T)(A/C/G)NN(A/T)GGC-3': 1, 5'-CAGATGGC-3' at 3629.
-# inverse complement, positive strand, positive direction is SuccessablesUSFboxci++.bas, looking for 5'-(C/T)(A/C/G)NN(A/T)GGC-3': 1, 5'-CAGGTGGC-3' at 1845.
-===Those containing an E-box (GTNNAC)===
-# inverse negative strand, negative direction is SuccessablesUSFboxi--.bas, looking for 5'-(A/G)(C/G/T)NN(A/T)CCG-3': 1, 5'-GTCTACCG-3' at 3629.
-# inverse negative strand, positive direction is SuccessablesUSFboxi-+.bas, looking for 5'-(A/G)(C/G/T)NN(A/T)CCG-3': 1, 5'-GTCCACCG-3' at 1845.
-# inverse positive strand, positive direction is SuccessablesUSFboxi++.bas, looking for 5'-(A/G)(C/G/T)NN(A/T)CCG-3': 3, 5'-GTCCACCG-3' at 198, 5'-GTGGACCG-3' at 2570 and 5'-GTAGACCG-3' at 3406.
-# complement, negative strand, negative direction is SuccessablesUSFboxc--.bas, looking for 5'-CGG(A/T)NN(A/C/G)(C/T)-3': 2, 5'-CGGTCCAC-3' at 2079 and 5'-CGGTCCAC-3' at 3953.
-# complement, positive strand, positive direction is SuccessablesUSFboxc++.bas, looking for 5'-CGG(A/T)NN(A/C/G)(C/T)-3': 1, 5'-CGGTGTAC-3' at 3707.
-==V boxes==
-{{main|V box gene transcriptions}}
-"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu/>
-In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.
-In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.
-==W boxes==
-{{main|W box gene transcriptions}}
-===Proximal promoters===
-Inverse W boxes occur in the negative strand, negative direction of A1BG: 5'-GGTCAA-3' at 4416 and 5'-GGTCAA-3' at 4308.
-W boxes occur in the positive direction, positive strand of A1BG: 5'-CTGACC-3' and its complement at 4216 and inverse W boxes occur 5'-GGTCAG-3' and its complement at 4270.
-===Distal promoters===
-A W box occurs 5'-CTGACC-3' at 3749, whereas 5'-CTGACT-3' at 17, 5'-TTGACT-3' at 130, 5'-TTGACT-3' at 307, and 5'-CTGACC-3' at 734 occur close to ZSCAN22, but 5'-CTGACT-3' at 1935 could be associated ZSCAN22 or an unknown gene between it and A1BG, along with their complements, negative strand, negative direction.
-Inverse complement, positive strand, negative direction there are 5: 5'-GGTCAG-3', 440, 5'-GGTCAG-3', 577, 5'-GGTCAG-3', 713, 5'-GGTCAG-3', 2249, 5'-GGTCAG-3', 2586.
-W box inverses occur 5'-GGTCAG-3' at 1353 negative direction.
-W boxes 5'-AGTCAG-3' at 2101, 5'-GGTCAG-3' at 2221, 5'-AGTCAG-3' at 2608, 5'-AGTCAA-3' at 2614, and 5'-AGTCAG-3' at 2619 along with their complements, positive direction.
-W boxes in the positive direction occur 5'-CTGACC-3' at 1662, 5'-CTGACC-3' at 2213, 5'-TTGACC-3' at 2873, 5'-CTGACT-3' at 2945, and 5'-TTGACC-3' at 4018 that could be associated with A1BG, along with 5'-TTGACC-3' at 1953, 5'-CTGACT-3' at 2674, and 5'-TTGACT-3' at 3735.
-Inverse complement, positive strand, positive direction there are 6: 5'-GGTCAG-3', 2025, 5'-AGTCAG-3', 2099, 5'-GGTCAG-3', 2606, 5'-GGTCAG-3', 2997, 5'-GGTCAG-3', 3083, 5'-GGTCAA-3', 3380.
-==X core promoter elements==
-{{main|X core promoter element gene transcriptions}}
-# negative strand in the negative direction, looking for 5'-G/A/T-G/C-G-T/C-G-G-G/A-A-G/C-A/C-3', 1, 5'-TGGTGGGACC-3', 3744 and complement,
-# inverse complement, positive strand, negative direction, looking for 5'-G/T-G/C-T-C/T-C-C-A/G-C-G/C-C/A/T-3', 1, 5'-GCTCCCACCT-3', 392 and complement, and
-# inverse, negative strand, positive direction, looking for 5'-A/C-G/C-A-G/A-G-G-T/C-G-G/C-G/A/T-3', 1, 5'-CCAGGGTGGG-3', 102.
-==Z boxes==
-{{main|Z box gene transcriptions}}
-"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of ''RbcS1A'' (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."<ref name=Song/>
-Z-boxes 1-3 contain 5'-AGGTG-3'.<ref name=Mejlvang>{{ cite journal
-|author=Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky
-|title=Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition
-|journal=Molecular Biology of the Cell
-|date=November 2007
-|volume=18
-|issue=11
-|pages=4615–4624
-|url=https://www.molbiolcell.org/doi/pdf/10.1091/mbc.e07-05-0406
-|arxiv=
-|bibcode=
-|doi=10.1091/mbc.e07-05-0406
-|pmid=17855508
-|accessdate=15 November 2018 }}</ref>
-===Z box distal promoters===
-Positive strand, negative direction:  3'-ACACCTGT-5' at 3970, 3'-ATACCTAT-5' at 2996, 3'-ACACCTGT-5' at 1131 and complements.
-Negative strand, positive direction: 5'-ACAGGTGT-3' at 1969 and complement.
-Positive strand, positive direction: 5'-ACACGTGT-3' at 2962 and complement.
-==Response element negative results==
-{| class="wikitable sortable"
-|+ Response elements not occurring in promoters near A1BG
-|-
-! Name of elements !! Consensus sequences !! Testing !! Notes
-|-
-| [[ABA-response element gene transcriptions|ABA-response elements]] || 5'-GATCGATC-3', 5'-CGATCGAT-3', 5'-ACGTGTCC-3', 5'-GATCGAT-3' || 16 || ABREN, CGATCGAT motif, ABRE, and core of ABREN and CGATCGAT motif.<ref name=Watanabe>{{ cite journal
-|author=Kenneth A. Watanabe, Arielle Homayouni, Lingkun Gu, Kuan‐Ying Huang, Tuan‐Hua David Ho, Qingxi J. Shen
-|title=Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element
-|journal=Plant, Cell & Environment
-|date=18 June 2017
-|volume=40
-|issue=9
-|pages=2004-2016
-|url=https://onlinelibrary.wiley.com/doi/full/10.1111/pce.13006
-|arxiv=
-|bibcode=
-|doi=10.1111/pce.13006
-|pmid=
-|accessdate=5 October 2020 }}</ref>
-|-
-| [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] || 5'-CGTCCTCTACG-3' || 16 || 5'-CGTNNNNNACGAT-3'<ref name=Rossi/>
-|-
-| [[Activating protein gene transcriptions|Activating proteins]] || 5'-GCCCACGGG-3' || 16 || Activating protein 2 (AP-2)<ref name=Murata/>
-|-
-| [[Activating protein gene transcriptions|Activating proteins]] || 5'-GGCCAA-3' || 16 || Activating protein 2 (AP-2)<ref name=Yao/>
-|-
-| [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || 5'-TATCCA-3' || 16 || 5'-TATCCATCCATCC-3'<ref name=Sharma/>
-|-
-| [[Amino acid response element gene transcriptions|Amino acid response elements]] || 5'-ATTGCATCA-3' || 16 || AARE1 (5'-ATTGCATCA-3')<ref name=Maruyama/>
-|-
-| [[Amino acid response element gene transcriptions|Amino acid response elements]] || 5'-TTTGCATCA-3' || 16 || 5'-TTTGCATCA-3'.<ref name=Broer>{{ cite journal
-|author=Angelika Bröer, Gregory Gauthier-Coles, Farid Rahimi, Michelle van Geldermalsen, Dieter Dorsch􏰀, Ansgar Wegener􏰀, Jeff Holst, and Stefan Bröer
-|title=Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells
-|journal=Journal of Biological Chemistry
-|date=March 15, 2019
-|volume=294
-|issue=11
-|pages=4012-4026
-|url=https://www.jbc.org/content/294/11/4012.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1074/jbc.RA118.006378
-|pmid=
-|accessdate=4 October 2020 }}</ref><ref name=Garaeva>{{ cite journal
-|author=Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva
-|title=Mitochondrial dysfunction induces ''SESN2'' gene expression through Activating Transcription Factor 4
-|journal=Cell Cycle
-|date=15 January 2016
-|volume=15
-|issue=1
-|pages=64-71
-|url=https://www.tandfonline.com/doi/full/10.1080/15384101.2015.1120929
-|arxiv=
-|bibcode=
-|doi=10.1080/15384101.2015.1120929
-|pmid=26771712
-|accessdate=5 September 2020 }}</ref>
-|-
-| [[Amino acid response element gene transcriptions|AARE-like]] || 5'-TGGTGAAAG-3' || 16 || AARE-like sequence (5′- TGGTGAAAG-3′, named AARE3)<ref name=Maruyama>{{ cite journal
-|author=Ryuto Maruyama, Makoto Shimizu, Juan Li, Jun Inoue & Ryuichiro Sato
-|title=''Fibroblast growth factor 21'' induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region
-|journal=Bioscience, Biotechnology, and Biochemistry
-|date=24 March 2016
-|volume=80
-|issue=5
-|pages=929-934
-|url=https://www.tandfonline.com/doi/pdf/10.1080/09168451.2015.1135045
-|arxiv=
-|bibcode=
-|doi=10.1080/09168451.2015.1135045
-|pmid=
-|accessdate=4 October 2020 }}</ref>
-|-
-| [[Androgen response element gene transcriptions|Androgen response elements]] || 5'-GGTACANNNTGTTCT-3'<ref name=Kouhpayeh/> || 16 || 5′-GGTACACGGTGTTCT-3′<ref name=Kouhpayeh>{{ cite journal
-|author=S Kouhpayeh, AR Einizadeh, Z Hejazi, M Boshtam, L Shariati, M Mirian, L Darzi, M Sojoudi, H Khanahmad and A Rezaei
-|title=Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line
-|journal=Cancer Gene Therapy
-|date=1 July 2016
-|volume=23
-|issue=
-|pages=254-257
-|url=https://www.researchgate.net/profile/Mina_Mirian/publication/304707422_Antiproliferative_effect_of_a_synthetic_aptamer_mimicking_androgen_response_elements_in_the_LNCaP_cell_line/links/59ffed00458515d0706e4f27/Antiproliferative-effect-of-a-synthetic-aptamer-mimicking-androgen-response-elements-in-the-LNCaP-cell-line.pdf
-|arxiv=
-|bibcode=
-|doi=10.1038/cgt.2016.26
-|pmid=
-|accessdate=3 October 2020 }}</ref>
-|-
-| [[Androgen response element gene transcriptions|Androgen response elements]] || 5'-TGATTCGTGAG-3' || 16 || 5'-AGAACANNNTGTTCT-3'<ref name=Wilson>{{ cite journal
-|author=Stephen Wilson, Jianfei Qi & Fabian V. Filipp
-|title=Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines
-|journal=Scientific Reports
-|date=14 September 2016
-|volume=6
-|issue=
-|pages=32611
-|url=https://www.nature.com/articles/srep32611
-|arxiv=
-|bibcode=
-|doi=10.1038/srep32611
-|pmid=
-|accessdate=3 October 2020 }}</ref>
-|-
-| [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]] || 5'-GTGAGGTCGC-3' || 16 || 5'-GTGAGGTCGC-3'<ref name=Otsuki>{{ cite journal
-|author=Akihito Otsuki, Mikiko Suzuki, Fumiki Katsuoka, Kouhei Tsuchida, Hiromi Suda, Masanobu Morita, Ritsuko Shimizu, Masayuki Yamamoto
-|title=Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection
-|journal=Free Radical Biology and Medicine
-|date=February 2016
-|volume=91
-|issue=
-|pages=45-57
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0891584915011478
-|arxiv=
-|bibcode=
-|doi=10.1016/j.freeradbiomed.2015.12.005
-|pmid=26677805
-|accessdate=21 August 2020 }}</ref> or 5'-GCTGAGT-3', 5'-GCAGGCT-3' of 5'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3'<ref name=Lacher>{{ cite journal
-|author=Sarah E. Lacher, Daniel C. Levings, Samuel Freeman, Matthew Slattery
-|title=Identification of a functional antioxidant response element at the HIF1A locus
-|journal=Redox Biology
-|date=October 2018
-|volume=19
-|issue=
-|pages=401-411
-|url=https://www.sciencedirect.com/science/article/pii/S2213231718305391
 |arxiv=
 |bibcode=
-|doi=10.1016/j.redox.2018.08.014
+|doi=10.1091/mbc.e07-05-0406
-|pmid=
+|pmid=17855508
-|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE)
+|accessdate=15 November 2018 }}</ref>
-|-
-| [[CAAT box gene transcriptions|CAAT boxes]] || 5'-(C/T)(A/G)(A/G)CCAATC(A/G)-3' || 16 || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT
+==Response element positive results==
-|-
+{{main|A1BG response element positive results}}
-| [[Calcium-response element gene transcriptions|Calcium-response elements]] || 5'-CTATTTCGAG-3' || 16 || CaRE1 5'-CTATTTCGAG-3'<ref name=Tao>{{ cite journal
-|author=Xu Tao, Anne E. West, Wen G. Chen, Gabriel Corfas, Michael E. Greenberg
-|title=A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF
-|journal=Neuron
-|date=2002
-|volume=33
-|issue=
-|pages=383-95
-|url=https://www.cell.com/neuron/fulltext/S0896-6273(01)00561-X?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS089662730100561X%3Fshowall%3Dtrue
-|arxiv=
-|bibcode=
-|doi=10.1016/S0896-6273(01)00561-X
-|pmid=11832226
-|accessdate=2 September 2020 }}</ref>
-|-
-| [[Cat8p gene transcriptions|Cat8ps]] || 5'-CGGTCCGC-3' || ⌘F || 5'-CGGNBNVMHGGA-3', 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'
-|-
-| [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || 5'-TCACGTGA-3' || 8 || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end
-|-
-| [[C box gene transcriptions|C-boxes]] || 5'-GAGGCCATCT-3' || 16 || 5'-GAGGCCATCT-3'<ref name=Johnson/>
-|-
-| [[C box gene transcriptions|C/A hybrid boxes]] || 5'-TGACGTAT-3' || 16 || 5'-TGACGTAT-3'<ref name=Song/>
-|-
-| [[C box gene transcriptions|C/T hybrid boxes]] || 5'-TGACGTTA-3' || 16 || 5'-TGACGTTA-3'<ref name=Song/>
-|-
-| [[C-EBP box gene transcriptions|C/EBP boxes]] || 5'-TTAGGACAT-3', or 5'-TAGCATT-3' || ⌘F || CCAAT-enhancer-binding site (C/EBP) is TAGCATT
-|-
-| [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] || 5'-CCCAACGGT-3' || ⌘F || tomato genome-wide analysis
-|-
-| [[CENP-B box gene transcriptions|CENP-B boxes]] || 5'-TTTCGTTGGAAGCGGGA-3' || 16 || specifically localized at the centromere
-|-
-| [[Circadian control element gene transcriptions|Circadian control elements]] || 5'-CAACTTTA-3' || ⌘F || CCE
-|-
-| [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors (CTCF)]] || 5'-NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T)-3' || 16 || 5′-NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C)-3′<ref name=Hashimoto>{{ cite journal
-|author=Hideharu Hashimoto, Dongxue Wang, John R. Horton, Xing Zhang, Victor G. Corces and Xiaodong Cheng
-|title=Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA
-|journal=Molecular Cell
-|date=1 June 2017
-|volume=66
-|issue=5
-|pages=711-720.e3
-|url=https://www.sciencedirect.com/science/article/pii/S1097276517303179
-|arxiv=
-|bibcode=
-|doi=10.1016/j.molcel.2017.05.004
-|pmid=28529057
-|accessdate=28 August 2020 }}</ref>
-|-
-| [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]] || 5'-TGATAAG-3' || ⌘F || DAF-16-associated element (DAE)<ref name=Li>{{ cite journal
-|author=Yan-Hui Li and Gai-Gai Zhang
-|title=Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in ''Caenorhabditis elegans''
-|journal=Oncotarget
-|date=12 April 2016
-|volume=7
-|issue=15
-|pages=19185-19192
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991374/
-|arxiv=
-|bibcode=
-|doi=10.18632/oncotarget.8313
-|pmid=2702736
-|accessdate=27 August 2020 }}</ref>
-|-
-| [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] || 5'-GTAAACA-3' || ⌘F || DAF-16 binding element (DBE)<ref name=Li/>
-|-
-| [[D box gene transcriptions|D boxes]] || 5'-GTTGTATAAC-3' || ⌘F || 5′-CTTATGTAAA-3′<ref name=Mracek>{{ cite journal
-|author=Philipp Mracek, Cristina Santoriello, M. Laura Idda, Cristina Pagano, Zohar Ben-Moshe, Yoav Gothilf, Daniela Vallone, Nicholas S. Foulkes
-|title=Regulation of ''per'' and ''cry'' Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression
-|journal=PLoS ONE
-|date=December 6, 2012
-|volume=7
-|issue=12
-|pages=e51278
-|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0051278
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pone.0051278
-|pmid=
-|accessdate=10 February 2019 }}</ref>
-|-
-| [[D box gene transcriptions|D-boxes]] || 5'-TCTCACA-3' || ⌘F || TCTCACATT(A/C)AATAAGTCA is a D-box.<ref name=Johnson/>
-|-
-| [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] || 5'-ATTTTCTTCA-3' || ⌘F || Defense and stress-responsive elements (DREs)
-|-
-| [[DNA damage response element gene transcriptions|DNA damage response elements (DREs)]] || 5'-TAGCCGCCG-3' or 5'-TTTCAAT-3' || ⌘F || in the upstream repression sequence (URS)
-|-
-| [[DNA replication-related element gene transcriptions|DNA replication-related elements]] || 5'-TATCGATA-3' || ⌘F || DNA replication-related element (DRE)<ref name=Hirose>{{ cite journal
-|author=Fumiko Hirose, Masamitsu Yamaguchi, Akio Matsukage
-|title=Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a ''Drosophila'' Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc
-|journal=Molecular and Cellular Biology
-|date=September 1999
-|volume=19
-|issue=9
-|pages=6020-6028
-|url=https://mcb.asm.org/content/19/9/6020.full
-|arxiv=
-|bibcode=
-|doi=10.1128/MCB.19.9.6020
-|pmid=10454549
-|accessdate=4 September 2020 }}</ref>
-|-
-| [[DREB box gene transcriptions|DREB boxes]] || 5'-TACCGACAT-3' || 16 || CRT/DREB box
-|-
-| [[EIF4E basal element gene transcriptions|EIF4E basal elements]] || 5'-TTACCCCCCCTT-3' || 16 || poly(C) motif
-|-
-| [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] || 5'-CCAAT-3' || ⌘F || 5'-CCAATGGGCTGAAAC-3' between ZNF497 and A1BG
-|-
-| [[Estrogen response element gene transcriptions|Estrogen response elements]] || 5'-AGGTTA-3' or 5'-GGTCAGGAT-3' || ⌘F || 5'-AGGTTATTGCCTCCT-3' or 5'-GGTCAGGATGAC-3'
-|-
-| [[Forkhead box gene transcriptions|Forkhead boxes]] || 5'-(A/G)(C/T)AAA(C/T)A-3' || ⌘F || 5'-GTAAACAA-3' FOXO1
-|-
-| [[Gal4p gene transcriptions|Gal4ps]] || 5'-CGGACCGC-3' || ⌘F || 5'-CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG-3'
-|-
-| [[G box gene transcriptions|G boxes]] || 5'-(G/T)CCACGTG(G/T)C-3' || ⌘F || no "perfect palindrome" G boxes in either promoter
-|-
-| [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || 5'-TGACTCA-3', 5'-TGAGTCA-3' || ⌘F || ACGT motif
-|-
-| [[Gcn4p gene transcriptions|Gcn4ps]] || 5'-ATGACTCTT-3' || ⌘F || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]
-|-
-| [[GLM box gene transcriptions|GLM boxes]] || 5′-(G/A)TGA(G/C)TCA(T/C)-3′ || 16 || GCN4-like motif
-|-
-| [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences (GAS)]] || 5'-TTCCTAGAA-3' || ⌘F || ALS-GAS1 between nt −633 and nt −625
-|-
-| [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || 5'-AACCGGTT-3' || ⌘F || also 5'-GACTGGTT-3'
-|-
-| [[TC element gene transcriptions|GT boxes]] || 5'-GGGGTGGGG-3' || ⌘F || (-78 to -69)
-|-
-| [[Hac1p gene transcriptions|Hac1ps]] || 5'-CAGCGTG-3' || ⌘F || Regulates the unfolded protein response
-|-
-| [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || 5'-AAAAAATTTC-3' || ⌘F || four nGAAn motifs
-|-
-| [[Hex gene transcriptions|Hex sequences]] || 5'-TGACGTGGC-3' || ⌘F || the Hex sequence (TGACGTGGC)<ref name=Song/>
-|-
-| [[HMG box gene transcriptions|HMG boxes]] || 5'-(A/T)(A/T)CAAAG-3' || ⌘F || two or more HMG boxes
-|-
-| [[C box gene transcriptions|Hybrid C, A boxes]] || 5'-TGACGTAT-3' || ⌘F || A at the 12 position
-|-
-| [[C box gene transcriptions|Hybrid C, G boxes]] || 5'-TGACGTGT-3' || ⌘F || G at the 12 position
-|-
-| [[C box gene transcriptions|Hybrid C, T boxes]] || 5'-TGACGTTA-3' || ⌘F || T at the 12 position
-|-
-| [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || 5'-GCCCTACGT-3' || ⌘F || composed of HIF-1α and HIF-1β
-|-
-| [[I box gene transcriptions|I boxes]] || 5'-GATAAG-3' || ⌘F || 5'-GGATGAGATAAGA-3'
-|-
-| [[Inositol, choline-responsive element gene transcriptions|Inositol, choline-responsive element]] || 5'-TYTTCACATGY-3' || ⌘F || 5'-TCTTCAC, TCTTCACAT-3'
-|-
-| [[Kozak sequence gene transcriptions|Kozak sequences]] || 5'-(GCC)GCC(A/G)CCATGG-3' || ⌘F || 5'-GAAAATGG-3'.<ref name=Matsumoto/>
-|-
-| [[L box gene transcriptions|L boxes]] || 5'-TAAATG(A/C/G)A-3' || ⌘F || L1 box
-|-
-| [[Maf recognition element gene transcriptions|MAREs]] || 5'-TGCTGA(G/C)TCAGCA-3' || ⌘F || and 5'-TGCTGA(GC/CG)TCAGCA-3'
-|-
-| [[M box gene transcriptions|M boxes]] || 5'-GTCATGTGCT-3' || ⌘F || upstream of the TATA box
-|-
-| [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || 5'-(A/C/T)(A/C/T)NC(C/T)(A/C/T)(A/C/T)(A/T)(A/C/T)(A/C/T)N(A/G)(C/G/T)(A/C/T)-3' || ⌘F || Genome-wide determinant search
-|-
-| [[Met31p box gene transcriptions|Met31ps]] || 5'-AAACTGTGG-3' || ⌘F || Sulfur amino acid metabolism [72]
-|-
-| [[Middle sporulation element gene transcriptions|Middle sporulation elements]] || 5'-C(A/G)CAAA(A/T)-3' || ⌘F || 5'-ACACAAA-3' (2017)
-|-
-| [[Motif ten element gene transcriptions|Motif ten elements]] || 5'-C-C/G-A-A/G-C-C/G-C/G-A-A-C-G-C/G-3' || 16 || Gene ID: 6309
-|-
-| [[Ndt80p gene transcriptions|Ndt80ps]] || 5'-TCCGCA-3' || ⌘F || 5'-DNCRCAAAW-3'
-|-
-| [[Nuclear factor Y gene transcriptions|Nuclear factor Y]] || 5'-TACCGACAT-3' || ⌘F || NF-Y is a trimeric complex
-|-
-| [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]] || 5'-GTTTCATCA-3' || ⌘F || only one nucleotide difference between the ''SESN2'' CARE and the ''ASNS''
-|-
-| [[Oaf1p gene transcriptions|Oaf1ps]] || 5'-(A/C/G/T)(A/C/G/T)(A/C/G/T)T(A/C/G/T)A(A/C/G/T)-3' || ⌘F || 5'-CGG(A/C/G/T)<sub>3</sub>T(A/C/G/T)A(A/C/G/T)<sub>9-12</sub>CCG-3'
-|-
-| [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] || 5'-TCCGCGGA-3' || ⌘F || Pdr1p/Pdr3p response element (PDRE)
-|-
-| [[Polycomb response element gene transcriptions|Polycomb response elements]] || 5'-CGCCATTT-3' || ⌘F || closely resembles the extended Pho-Phol consensus sequence
-|-
-| [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || 5'-C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T)-3' || ⌘F || Rap1 (CCCACCAACAAAA) none
-|-
-| [[Rgt1p gene transcriptions|Rgt1ps]] || 5'-CGGACCA-3' || ⌘F || Glucose-responsive transcription factor
-|-
-| [[Rlm1p gene transcriptions|Rlm1ps]] || 5'-CTATATATAG-3' || ⌘F || CTA(T/A)<sub>4</sub>TAG
-|-
-| [[Rox1p gene transcriptions|Rox1ps]] || 5'-GGGTAA-3' || ⌘F || Heme-dependent repressor of hypoxic genes [78]
-|-
-| [[Rpn4p gene transcriptions|Rpn4ps]] || 5'-GGTGGCAAA-3' || ⌘F || proteasome genes
-|-
-| [[Seed-specific element gene transcriptions|Seed-specific elements]] || 5'-CATGCATG-3' || ⌘F || SRE consensus: 5'-CAGCAGATTGCG-3' is none
-|-
-| [[Shoot specific element gene transcriptions|Shoot specific elements]] || 5'-GATAATGATG-3' || ⌘F || SRE consensus: 5'-CAGCAGATTGCG-3' is none
-|-
-| [[Sip4p gene transcriptions|Sip4ps]] || 5'-CCGTCCGT-3' || ⌘F || 5'-CC(C/G)T(C/T)C(C/G)TCCG-3'
-|-
-| [[Smp1p gene transcriptions|Smp1ps]] || 5'-ACTACTA-3' || ⌘F || 5-ACTACTA(T/A)4TAG-3'
-|-
-| [[Sterol response element gene transcriptions|Sterol response elements]] || 5'-TCGTATA-3' || ⌘F || perhaps plant specific
-|-
-| [[TATC box gene transcriptions|TATCCAC boxes]] || 5'-TATCCAC-3' || 16 || GA responsive complex component
-|-
-| [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || 5'-TCCACCATA-3' || ⌘F || adjacent co-dependent regulatory element of POLLEN1
-|-
-| [[Tec1p gene transcriptions|Tec1ps]] || 5'-GAATGT-3' || ⌘F || Ste12p cofactor
-|-
-| [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements (TREs)]] || 5'-TGA(G/C)TCA-3' || 16 || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
-|-
-| [[TC element gene transcriptions|TGF-β control elements (TCEs)]] || 5'-GAGTGGGGCG-3' || ⌘F || in mouse and rat, 5'-GCGTGGGGGA-3' in humans
-|-
-| [[TC element gene transcriptions|TGF-β inhibitory elements (TIEs)]] || 5'-GAGTGGTGA-3' || 16 || in the rat transin/stromelysin promoter
-|-
-| [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements (TREs)]] || 5'-AGGTCA-3' || ⌘F || See VDREs, X boxes
-|-
-| [[Unfolded protein response element gene transcriptions|Unfolded protein response elements (UPREs)]] || 5'-TGACGTG(G/A)-3' || ⌘F || XBP1 binds to UPRE
-|-
+==Response element negative results==
-| [[Vhr1p gene transcriptions|Vhr1ps]] || 5'-AATCA-N<sub>8</sub>-TGA(C/T)T-3' || ⌘F || Response to low biotin [71] concentrations
+{{main|A1BG response element negative results}}
-|-
-| [[Vitamin D response element gene transcriptions|Vitamin D response elements (VDREs)]] || 5'-(A/G)G(G/T)(G/T)CA-3' || ⌘F || 5'-AGGTCA-3' not ⌘F
-|-
-| [[X box gene transcriptions|X boxes]] || 5'-GTTGGCATGGCAAC-3' || 16 || X2 box is 5'-AGGTCCA-3' not ⌘F
-|-
-| [[Xbp1p gene transcriptions|Xbp1ps]] || 5'-GcCTCGA(G/A)G(C/A)g(a/g)-3' || ⌘F || Transcriptional repressor
-|-
-| [[Xenobiotic response element gene transcriptions|Xenobiotic response elements (XREs)]] || 5'-(T/G)NGCGTG(A/C)(G/C)A-3' || ⌘F || contains the core sequence 5'-GCGTG-3'
-|-
-| [[Yap1p,2p gene transcriptions|Yap1p,2ps]] || 5'-TTACTAA-3' || ⌘F || Yap1p binding sites
-|-
-| [[Y box gene transcriptions|Y boxes]] || 5'-(A/G)CTAACC(A/G)(A/G)(C/T)-3' || 16 || inverted CAAT box
-|-
-| [[Zap1p gene transcriptions|Zap1ps]] || 5'-ACCCTCA-3' || ⌘F || 5'-ACC(C/T)(C/T)(A/C/G/T)AAGGT-3'
-|-
-|}
 ==Hypotheses==
@@ Line 3,054: / Line 3,119: @@
 ==See also==
 {{div col|colwidth=20em}}
+* [[A1BG gene transcription core promoters]]
 * [[A1BG gene transcriptions]]
+* [[A1BG regulatory elements and regions]]
+* [[A1BG response element gene transcriptions]]
+* [[A1BG response element negative results]]
+* [[A1BG response element positive results]]
 * [[Alpha-1-B glycoprotein]]
+* [[Complex locus A1BG and ZNF497]]
 * [[Immunoglobulin domain cl11960]]
 * [[Immunoglobulin like domain cd05751]]
@@ Line 3,078: / Line 3,149: @@
 <!-- footer categories -->
-[[Category:Resources last modified in October 2020]]
+[[Category:Resources last modified in April 2021]]