Serum response element gene transcriptions

Jump to navigation Jump to search

Associate Editor(s)-in-Chief: Henry A. Hoff

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)6GG (CArG) motif."[2]

"The “CCATAATAGG” sequence in the SIRT2 gene promoter is a classic SRE, which allows the SRF dimer to firmly bind to the DNA sequence, whereupon various SRF-binding proteins may be recruited to form a protein complex, which in turn modulates the expression of the SIRT2 gene."[2]

Consensus sequences

In the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC,

5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG,

5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG,

5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F",

5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.

SRE samplings

SRE samplings

Copying a responsive elements consensus sequence ACAGGATGT and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACAGGATGT (starting with SuccessablesSER.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for ACAGGATGT, 0.
  2. positive strand, negative direction, looking for ACAGGATGT, 0.
  3. negative strand, positive direction, looking for ACAGGATGT, 1, ACAGGATGT at 3575.
  4. positive strand, positive direction, looking for ACAGGATGT, 0.
  5. complement, negative strand, negative direction, looking for TGTCCTACA, 0.
  6. complement, positive strand, negative direction, looking for TGTCCTACA, 0.
  7. complement, positive strand, positive direction, looking for TGTCCTACA, 1, TGTCCTACA at 3575.
  8. complement, negative strand, positive direction, looking for TGTCCTACA, 0.
  9. inverse complement, negative strand, negative direction, looking for ACATCCTGT, 0.
  10. inverse complement, positive strand, negative direction, looking for ACATCCTGT, 0.
  11. inverse complement, negative strand, positive direction, looking for ACATCCTGT, 0.
  12. inverse complement, positive strand, positive direction, looking for ACATCCTGT, 0.
  13. inverse negative strand, negative direction, looking for TGTAGGACA, 0.
  14. inverse positive strand, negative direction, looking for TGTAGGACA, 0.
  15. inverse positive strand, positive direction, looking for TGTAGGACA, 0.
  16. inverse negative strand, positive direction, looking for TGTAGGACA, 0.

SRE positive direction (4050-1) distal promoters

  1. Negative strand, positive direction: ACAGGATGT at 3575.

SRE random dataset samplings

  1. SREr0: 0.
  2. SREr1: 0.
  3. SREr2: 0.
  4. SREr3: 0.
  5. SREr4: 0.
  6. SREr5: 0.
  7. SREr6: 0.
  8. SREr7: 0.
  9. SREr8: 0.
  10. SREr9: 0.
  11. SREr0ci: 0.
  12. SREr1ci: 0.
  13. SREr2ci: 0.
  14. SREr3ci: 0.
  15. SREr4ci: 0.
  16. SREr5ci: 0.
  17. SREr6ci: 0.
  18. SREr7ci: 0.
  19. SREr8ci: 0.
  20. SREr9ci: 0.

SRE analysis and results

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGT+CCATA+TTAGG+A+CAT+CTG+C, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]

Reals or randoms Promoters direction Numbers Strands Occurrences Averages (± 0.1)
Reals UTR negative 0 2 0 0
Randoms UTR arbitrary negative 0 10 0 0
Randoms UTR alternate negative 0 10 0 0
Reals Core negative 0 2 0 0
Randoms Core arbitrary negative 0 10 0 0
Randoms Core alternate negative 0 10 0 0
Reals Core positive 0 2 0 0
Randoms Core arbitrary positive 0 10 0 0
Randoms Core alternate positive 0 10 0 0
Reals Proximal negative 0 2 0 0
Randoms Proximal arbitrary negative 0 10 0 0
Randoms Proximal alternate negative 0 10 0 0
Reals Proximal positive 0 2 0 0
Randoms Proximal arbitrary positive 0 10 0 0
Randoms Proximal alternate positive 0 10 0 0
Reals Distal negative 0 2 0 0
Randoms Distal arbitrary negative 0 10 0 0
Randoms Distal alternate negative 0 10 0 0
Reals Distal positive 1 2 0.5 0.5 ± 0.5 (-+1,++0)
Randoms Distal arbitrary positive 0 10 0 0
Randoms Distal alternate positive 0 10 0 0

Comparison:

The occurrences of real SREs are greater than the randoms. This suggests that the real SREs are likely active or activable.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. 1.0 1.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E. Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  2. 2.0 2.1 Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei (21 December 2017). "SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation". PLOS One. 12 (12): e0190011. doi:10.1371/journal.pone.0190011. Retrieved 23 February 2021.