STAT5 gene transcription laboratory: Difference between revisions
m (→Core promoters) |
|||
(14 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
Expensive equipment can be replaced or substituted for with more readily available tools. | Expensive equipment can be replaced or substituted for with more readily available tools. | ||
{{clear}} | {{clear}} | ||
Line 50: | Line 42: | ||
I will provide an example. The rest is up to you. | I will provide an example. The rest is up to you. | ||
Questions, if any, are best placed on the [[Talk: | Questions, if any, are best placed on the [[Talk:STAT5 gene transcription laboratory|Discuss]] page. | ||
To include your participation in each of these laboratories create a subpage of your user page once you register at wikiversity and use this subpage, for example, [[:User:your online name|your online name/laboratory effort]]. | To include your participation in each of these laboratories create a subpage of your user page once you register at wikiversity and use this subpage, for example, [[:User:your online name|your online name/laboratory effort]]. | ||
Line 73: | Line 65: | ||
|title=Role of STATs as downstream signal transducers in Src family kinase-mediated tumorigenesis | |title=Role of STATs as downstream signal transducers in Src family kinase-mediated tumorigenesis | ||
|journal=Oncogene | |journal=Oncogene | ||
| | |date=2004 | ||
|volume=23 | |volume=23 | ||
|issue= | |issue= | ||
Line 97: | Line 88: | ||
|title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression | |title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression | ||
|journal=Journal of Molecular Endocrinology | |journal=Journal of Molecular Endocrinology | ||
| | |date=1 December 2006 | ||
|volume=37 | |volume=37 | ||
|issue=3 | |issue=3 | ||
Line 166: | Line 156: | ||
==Proximal promoters== | ==Proximal promoters== | ||
{{main| | {{main|Proximal promoter gene transcriptions|Proximal promoters}} | ||
'''Def.''' a "promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.<sup>[12][13]</sup>"<ref name=Shafee>{{ cite journal | '''Def.''' a "promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.<sup>[12][13]</sup>"<ref name=Shafee>{{ cite journal | ||
|author=Thomas Shafee and Rohan Lowe | |author=Thomas Shafee and Rohan Lowe | ||
|title=Eukaryotic and prokaryotic gene structure | |title=Eukaryotic and prokaryotic gene structure | ||
|journal=WikiJournal of Medicine | |journal=WikiJournal of Medicine | ||
| | |date=9 March 2017 | ||
|volume=4 | |volume=4 | ||
|issue=1 | |issue=1 | ||
Line 192: | Line 181: | ||
==Distal promoters== | ==Distal promoters== | ||
{{main| | {{main|Distal promoter gene transcriptions|Distal promoters}} | ||
The "upstream regions of the human CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene."<ref name=Takayama>{{ cite journal | The "upstream regions of the human CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene."<ref name=Takayama>{{ cite journal | ||
|author=Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura | |author=Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura | ||
|title=Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters | |title=Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters | ||
|journal=The Journal of Biochemistry | |journal=The Journal of Biochemistry | ||
| | |date=1 July 1994 | ||
|volume=116 | |volume=116 | ||
|issue=1 | |issue=1 | ||
Line 213: | Line 201: | ||
|title=Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro | |title=Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro | ||
|journal=Proceedings of the National Academy of Sciences of the United States of America | |journal=Proceedings of the National Academy of Sciences of the United States of America | ||
| | |date=8 July 1997 | ||
|volume=94 | |volume=94 | ||
|issue=14 | |issue=14 | ||
Line 229: | Line 216: | ||
|title=Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter | |title=Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter | ||
|journal=Biochemical and Biophysical Research Communications | |journal=Biochemical and Biophysical Research Communications | ||
| | |date=March 1990 | ||
|volume=167 | |volume=167 | ||
|issue=2 | |issue=2 | ||
Line 243: | Line 229: | ||
|title=Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells | |title=Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells | ||
|journal=Molecular Endocrinology | |journal=Molecular Endocrinology | ||
| | |date=June 1996 | ||
|volume=10 | |volume=10 | ||
|issue=6 | |issue=6 | ||
Line 259: | Line 244: | ||
|title=Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences | |title=Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences | ||
|journal=Blood | |journal=Blood | ||
| | |date=July 15, 1998 | ||
|volume=92 | |volume=92 | ||
|issue=2 | |issue=2 | ||
Line 275: | Line 259: | ||
If there are any transcription factors between ZNF497 and A1BG, they are inside the gene for ZNF497 as there are only 858 nts between them. The data set in the ZNF497 positive direction has been extended to just beyond ZNF497. | If there are any transcription factors between ZNF497 and A1BG, they are inside the gene for ZNF497 as there are only 858 nts between them. The data set in the ZNF497 positive direction has been extended to just beyond ZNF497. | ||
== | ==STAT5 samplings== | ||
{{main| | {{main|Sampling models|Samplings}} | ||
[[Image:Signal transduction pathways.svg|right|thumb|300px|Major signal transduction pathways in mammals are diagrammed. Credit: cybertory.{{tlx|free media}}]] | |||
Once you've decided on an entity, source, or object, compose a method, way, or procedure to explore it. | Once you've decided on an entity, source, or object, compose a method, way, or procedure to explore it. | ||
Line 292: | Line 277: | ||
Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG. | Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG. | ||
'''Def.''' a series of chemical reactions within a cell which start when a transmembrane protein comes into contact with a chemical signal, resulting in a second messenger being triggered is called a '''signal transduction'''. | '''Def.''' a series of chemical reactions within a cell which start when a transmembrane protein comes into contact with a chemical signal, resulting in a second messenger being triggered is called a '''signal transduction'''. | ||
Line 299: | Line 284: | ||
STAT5s may have a downstream proximal promoter element. "Downstream" can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. | STAT5s may have a downstream proximal promoter element. "Downstream" can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. | ||
As is shown in the [[ | As is shown in the [[A1BG gene transcription programming|computer programming]] sampling is performed to 100 nts past the TSS. | ||
{{clear}} | {{clear}} | ||
Line 306: | Line 291: | ||
For the Basic programs (starting with SuccessablesSTAT5.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found: | For the Basic programs (starting with SuccessablesSTAT5.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found: | ||
# negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesSTAT5--.bas, looking for 3'-TTCNNNGAA-5', 0, | # negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesSTAT5--.bas, looking for 3'-TTCNNNGAA-5', 0, | ||
# positive strand in the negative direction is SuccessablesSTAT5+-.bas, looking for 3'-TTCNNNGAA-5', 2, 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782, | |||
# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesSTAT5-+.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCGGGAA-5', 4247, | # negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesSTAT5-+.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCGGGAA-5', 4247, | ||
# positive strand in the positive direction is SuccessablesSTAT5++.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCATGAA-5', 128, | # positive strand in the positive direction is SuccessablesSTAT5++.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCATGAA-5', 128, | ||
# complement, negative strand, negative direction is SuccessablesSTAT5c--.bas, looking for 3'-AAGNNNCTT-5', 2, 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782, | # complement, negative strand, negative direction is SuccessablesSTAT5c--.bas, looking for 3'-AAGNNNCTT-5', 2, 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782, | ||
Line 327: | Line 312: | ||
"NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."<ref name=Gardmo/> | "NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."<ref name=Gardmo/> | ||
===STAT5 (4560-2846) UTRs=== | |||
# Positive strand, negative direction: 2, TTCCCTGAA at 3782, TTCGTTGAA at 3506. | |||
===STAT5 positive direction (4265-4050) proximal promoters=== | |||
# Negative strand, positive direction: TTCCGGGAA at 4247. | |||
===STAT5 positive direction (4050-1) distal promoters=== | |||
# Positive strand, positive direction: TTCCATGAA at 128. | |||
==STAT5 random dataset samplings== | |||
# STAT5r0: 0. | |||
# STAT5r1: 3, TTCGCTGAA at 2712, TTCCCCGAA at 2455, TTCTCAGAA at 1534. | |||
# STAT5r2: 0. | |||
# STAT5r3: 1, TTCTTGGAA at 4224. | |||
# STAT5r4: 2, TTCTCCGAA at 3875, TTCGCGGAA at 2553. | |||
# STAT5r5: 2, TTCTCCGAA at 3383, TTCGTGGAA at 633. | |||
# STAT5r6: 2, TTCGGAGAA at 4247, TTCTGGGAA at 1361. | |||
# STAT5r7: 1, TTCAGCGAA at 3753. | |||
# STAT5r8: 1, TTCCATGAA at 1472. | |||
# STAT5r9: 2, TTCGTTGAA at 4241, TTCTATGAA at 2350. | |||
===STAT5r arbitrary (evens) (4560-2846) UTRs=== | |||
# STAT5r4: TTCTCCGAA at 3875. | |||
# STAT5r6: TTCGGAGAA at 4247. | |||
===STAT5r alternate (odds) (4560-2846) UTRs=== | |||
# STAT5r3: TTCTTGGAA at 4224. | |||
# STAT5r5: TTCTCCGAA at 3383. | |||
# STAT5r7: TTCAGCGAA at 3753. | |||
# STAT5r9: TTCGTTGAA at 4241. | |||
===STAT5r alternate negative direction (odds) (2811-2596) proximal promoters=== | |||
# STAT5r1: TTCGCTGAA at 2712. | |||
===STAT5r arbitrary positive direction (odds) (4265-4050) proximal promoters=== | |||
# STAT5r3: TTCTTGGAA at 4224. | |||
# STAT5r9: TTCGTTGAA at 4241. | |||
===STAT5r alternate positive direction (evens) (4265-4050) proximal promoters=== | |||
# STAT5r6: TTCGGAGAA at 4247. | |||
===STAT5r arbitrary negative direction (evens) (2596-1) distal promoters=== | |||
# STAT5r4: TTCGCGGAA at 2553. | |||
# STAT5r6: TTCTGGGAA at 1361. | |||
===STAT5r alternate negative direction (odds) (2596-1) distal promoters=== | |||
# STAT5r1: TTCCCCGAA at 2455, TTCTCAGAA at 1534. | |||
# STAT5r5: TTCGTGGAA at 633. | |||
# STAT5r9: TTCTATGAA at 2350. | |||
===STAT5r arbitrary positive direction (odds) (4050-1) distal promoters=== | |||
# STAT5r1: TTCGCTGAA at 2712, TTCCCCGAA at 2455, TTCTCAGAA at 1534. | |||
# STAT5r5: TTCTCCGAA at 3383, TTCGTGGAA at 633. | |||
# STAT5r7: TTCAGCGAA at 3753. | |||
# STAT5r9: TTCTATGAA at 2350. | |||
===STAT5r alternate positive direction (evens) (4050-1) distal promoters=== | |||
# STAT5r4: TTCTCCGAA at 3875, TTCGCGGAA at 2553. | |||
# STAT5r6: TTCTGGGAA at 1361. | |||
==STAT5 analysis and results== | |||
{{main|Complex locus A1BG and ZNF497#STAT5s}} | |||
STAT5 consensus sequence is TTCXXXGAA, where X = A, C, or G.<ref name=Gardmo/> Or, X = G or T.<ref name=Silva/> The inverse complement is the same as the direct. | |||
{|class="wikitable" | |||
|- | |||
! Reals or randoms !! Promoters !! direction !! Numbers !! Strands !! Occurrences !! Averages (± 0.1) | |||
|- | |||
| Reals || UTR || negative || 2 || 2 || 1 || 1 ± 1 (--0,+2) | |||
|- | |||
| Randoms || UTR || arbitrary negative || 2 || 10 || 0.2 || 0.3 | |||
|- | |||
| Randoms || UTR || alternate negative || 4 || 10 || 0.4 || 0.3 | |||
|- | |||
| Reals || Core || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Core || arbitrary negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Core || alternate negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Core || positive || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Core || arbitrary positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Core || alternate positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Proximal || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Proximal || arbitrary negative || 0 || 10 || 0 || 0.05 | |||
|- | |||
| Randoms || Proximal || alternate negative || 1 || 10 || 0.1 || 0.05 | |||
|- | |||
| Reals || Proximal || positive || 1 || 2 || 0.5 || 0.5 ± 0.5 (-+1,++0) | |||
|- | |||
| Randoms || Proximal || arbitrary positive || 2 || 10 || 0.2 || 0.15 | |||
|- | |||
| Randoms || Proximal || alternate positive || 1 || 10 || 0.1 || 0.15 | |||
|- | |||
| Reals || Distal || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Distal || arbitrary negative || 2 || 10 || 0.2 || 0.3 | |||
|- | |||
| Randoms || Distal || alternate negative || 4 || 10 || 0.4 || 0.3 | |||
|- | |||
| Reals || Distal || positive || 1 || 2 || 0.5 || 0.5 ± 0.5 (-+0,++1) | |||
|- | |||
| Randoms || Distal || arbitrary positive || 7 || 10 || 0.7 || 0.5 | |||
|- | |||
| Randoms || Distal || alternate positive || 3 || 10 || 0.3 || 0.5 | |||
|} | |||
Comparison: | |||
The occurrences of real STAT5 UTRs, proximals and distals are greater than the randoms. This suggests that the real STAT5s are likely active or activable. | |||
==Verifications== | ==Verifications== | ||
Line 365: | Line 478: | ||
There are the following STAT5s on the positive strand, negative direction: 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782. | There are the following STAT5s on the positive strand, negative direction: 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782. | ||
And, their complements on the negative strand, negative direction: 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782. | And, their complements on the negative strand, negative direction: 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782. | ||
Line 375: | Line 489: | ||
|title=Nuclear factor I and mammary gland factor (STAT5) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice | |title=Nuclear factor I and mammary gland factor (STAT5) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice | ||
|journal=Molecular and Cellular Biology | |journal=Molecular and Cellular Biology | ||
| | |date=April 1995 | ||
|volume=15 | |volume=15 | ||
|issue=4 | |issue=4 | ||
Line 391: | Line 504: | ||
|title=Prolactin signals via Stat5 and Oct-1 to the proximal cyclin D1 promoter | |title=Prolactin signals via Stat5 and Oct-1 to the proximal cyclin D1 promoter | ||
|journal=Molecular and Cellular Endocrinology | |journal=Molecular and Cellular Endocrinology | ||
| | |date=15 July 2005 | ||
|volume=239 | |volume=239 | ||
|issue=1–2 | |issue=1–2 | ||
Line 409: | Line 521: | ||
|title=Differential Interactions of Specific Nuclear Factor I Isoforms with the Glucocorticoid Receptor and STAT5 in the Cooperative Regulation of WAP Gene Transcription | |title=Differential Interactions of Specific Nuclear Factor I Isoforms with the Glucocorticoid Receptor and STAT5 in the Cooperative Regulation of WAP Gene Transcription | ||
|journal=Molecular and Cellular Biology | |journal=Molecular and Cellular Biology | ||
| | |date=October 2001 | ||
|volume=21 | |volume=21 | ||
|issue=20 | |issue=20 | ||
Line 425: | Line 536: | ||
|title=A distal region in the interferon-γ gene is a site of epigenetic remodeling and transcriptional regulation by interleukin-2 | |title=A distal region in the interferon-γ gene is a site of epigenetic remodeling and transcriptional regulation by interleukin-2 | ||
|journal=Journal of Biological Chemistry | |journal=Journal of Biological Chemistry | ||
| | |date=24 September 2004 | ||
|volume=279 | |volume=279 | ||
|issue= | |issue= | ||
Line 441: | Line 551: | ||
|title=Progesterone Induction of the 11β-Hydroxysteroid Dehydrogenase Type 2 Promoter in Breast Cancer Cells Involves Coordinated Recruitment of STAT5A and Progesterone Receptor to a Distal Enhancer and Polymerase Tracking | |title=Progesterone Induction of the 11β-Hydroxysteroid Dehydrogenase Type 2 Promoter in Breast Cancer Cells Involves Coordinated Recruitment of STAT5A and Progesterone Receptor to a Distal Enhancer and Polymerase Tracking | ||
|journal=Molecular and Cellular Biology | |journal=Molecular and Cellular Biology | ||
| | |date=June 2008 | ||
|volume=28 | |volume=28 | ||
|issue=11 | |issue=11 | ||
Line 457: | Line 566: | ||
|title=Hypomethylation of IL10 and IL13 Promoters in CD4 | |title=Hypomethylation of IL10 and IL13 Promoters in CD4 | ||
|journal=Journal of Biomedicine and Biotechnology | |journal=Journal of Biomedicine and Biotechnology | ||
| | |date=September 2010 | ||
|volume=2010 | |volume=2010 | ||
|issue=9 | |issue=9 | ||
Line 489: | Line 597: | ||
|title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma | |title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma | ||
|journal=Biochemistry | |journal=Biochemistry | ||
| | |date=October 2004 | ||
|volume=43 | |volume=43 | ||
|issue=40 | |issue=40 | ||
Line 505: | Line 612: | ||
An '''AGC box''' was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG. | An '''AGC box''' was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG. | ||
A full web search produced several references including a GeneCard<ref name=ZNF497>{{ cite | A full web search produced several references including a GeneCard<ref name=ZNF497>{{ cite web | ||
|author=Weizmann Institute of Science | |author=Weizmann Institute of Science | ||
|title=Zinc Finger Protein 497 | |title=Zinc Finger Protein 497 | ||
|publisher=Weizmann Institute of Science | |publisher=Weizmann Institute of Science | ||
|location=Israel | |location=Israel | ||
|date= 2017 | |date=2017 | ||
|url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=ZNF497 | |url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=ZNF497 | ||
|accessdate=2017-08-20 }}</ref> for "zinc finger protein 497" and "GCC box", including "May be involved in transcriptional regulation."<ref name=ZNF497/> Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG. | |accessdate=2017-08-20 }}</ref> for "zinc finger protein 497" and "GCC box", including "May be involved in transcriptional regulation."<ref name=ZNF497/> Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG. | ||
Line 520: | Line 627: | ||
|title=FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis | |title=FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis | ||
|journal=Proceedings of the National Academy of Sciences United States of America | |journal=Proceedings of the National Academy of Sciences United States of America | ||
| | |date=19 April 2011 | ||
|volume=108 | |volume=108 | ||
|issue=16 | |issue=16 | ||
Line 554: | Line 660: | ||
|title=Adaptive Evolution Drives the Diversification of Zinc-Finger Binding Domains | |title=Adaptive Evolution Drives the Diversification of Zinc-Finger Binding Domains | ||
|journal=Molecular Biology and Evolution | |journal=Molecular Biology and Evolution | ||
| | |date=1 December 2004 | ||
|volume=21 | |volume=21 | ||
|issue=12 | |issue=12 | ||
Line 582: | Line 687: | ||
|title=Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG | |title=Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG | ||
|journal=Clinical genetics | |journal=Clinical genetics | ||
| | |date=1 December 1989 | ||
|volume=36 | |volume=36 | ||
|issue=6 | |issue=6 | ||
Line 599: | Line 703: | ||
|title=Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice | |title=Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice | ||
|journal=Biochimica et Biophysica Acta (BBA) - General Subjects | |journal=Biochimica et Biophysica Acta (BBA) - General Subjects | ||
| | |date=January 2007 | ||
|volume=1770 | |volume=1770 | ||
|issue=1 | |issue=1 | ||
Line 615: | Line 718: | ||
|title=Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes | |title=Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes | ||
|journal=Hypertension | |journal=Hypertension | ||
| | |date=June 2013 | ||
|volume=62 | |volume=62 | ||
|issue=1 | |issue=1 | ||
Line 697: | Line 799: | ||
|title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression | |title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression | ||
|journal=Journal of Molecular Endocrinology | |journal=Journal of Molecular Endocrinology | ||
| | |date=1 December 2006 | ||
|volume=37 | |volume=37 | ||
|issue=3 | |issue=3 | ||
Line 751: | Line 852: | ||
Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for | Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for | ||
# [[ | # [[CArG box gene transcription laboratory|CArG boxes]], | ||
# [[ | # [[Enhancer box gene transcription laboratory|Enhancer boxes]], | ||
# [[ | # [[HY box gene transcriptions laboratory|HY boxes]] and | ||
# [[ | # [[Metal responsive gene transcription laboratory|MREs]]. | ||
The STAT5 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the STAT5 on the ZSCAN22 side to be used in analogy to the STAT5 on the same side as in the rat.<ref name=Gardmo/> | The STAT5 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the STAT5 on the ZSCAN22 side to be used in analogy to the STAT5 on the same side as in the rat.<ref name=Gardmo/> | ||
Line 773: | Line 874: | ||
==See also== | ==See also== | ||
{{div col|colwidth= | {{div col|colwidth=20em}} | ||
* [[ | * [[A1BG gene transcription core promoters]] | ||
* [[ | * [[A1BG gene transcriptions]] | ||
* [[ | * [[A1BG regulatory elements and regions]] | ||
* [[ | * [[A1BG response element negative results]] | ||
* [[ | * [[A1BG response element positive results]] | ||
* [[ | * [[AGC box gene transcription laboratory|AGC box transcription laboratory]] | ||
* [[CArG box gene transcription laboratory|CArG box transcription laboratory]] | |||
* [[Complex locus A1BG and ZNF497]] | |||
* [[Enhancer box gene transcription laboratory|Enhancer box transcription laboratory]] | |||
* [[HY box gene transcription laboratory|HY box transcription laboratory]] | |||
* [[Metal responsive element gene transcription laboratory|Metal responsive elements laboratory]] | |||
{{Div col end}} | {{Div col end}} | ||
Line 787: | Line 892: | ||
==External links== | ==External links== | ||
* [http://www. | * [http://www.genome.jp/ GenomeNet KEGG database] | ||
* [http:// | * [http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene Home - Gene - NCBI] | ||
* [http://www.ncbi.nlm.nih.gov/sites/gquery NCBI All Databases Search] | * [http://www.ncbi.nlm.nih.gov/sites/gquery NCBI All Databases Search] | ||
* [http://www. | * [http://www.ncbi.nlm.nih.gov/ncbisearch/ NCBI Site Search] | ||
* [http://www.ncbi.nlm.nih.gov/pccompound PubChem Public Chemical Database] | * [http://www.ncbi.nlm.nih.gov/pccompound PubChem Public Chemical Database] | ||
<!-- footer templates --> | <!-- footer templates --> | ||
{{Gene project | {{Gene project}} | ||
<!-- categories --> | <!-- categories --> | ||
[[Category:Biochemistry laboratories]] | [[Category:Biochemistry laboratories]] | ||
[[Category:Genetics laboratories]] | [[Category:Genetics laboratories]] | ||
[[Category:Resources last modified in | [[Category:Resources last modified in January 2021]] |
Latest revision as of 19:48, 25 July 2023
Editor-In-Chief: Henry A. Hoff
A laboratory is a specialized activity where a student, teacher, or researcher can have hands-on, or as close to hands-on as possible, experience actively analyzing an entity, source, or object of interest.
Usually, expensive equipment, instruments, and/or machinery are available for taking the entity apart to see and accurately record how it works, what it's made of, and where it came from. This may involve simple experiments to test reality, collect data, and attempts to make some sense out of it.
Expensive equipment can be replaced or substituted for with more readily available tools.
Notations
You are free to create your own notation or use that already presented. A method to statistically assess your locator is also needed.
Laboratory control group
A laboratory control group of some large number of laboratory test subjects or results may be used to define normal limits for the presence of an effect.
Instructions
This laboratory is an activity for you to explore the universe for, to create a method for, or to examine. While it is part of the {{Gene project}}
, it is also independent.
Some suggested entities to consider are
- available classification,
- human genes,
- eukaryotes,
- nucleotides,
- classical physics quantities,
- known gene expressions, or
- geometry.
More importantly, there are your entities.
You may choose to define your entities or use those already available.
Usually, research follows someone else's ideas of how to do something. But, in this laboratory you can create these too.
This is a gene project laboratory, but you may create what a laboratory, or a {{Gene project}}
is.
This laboratory is structured.
I will provide an example. The rest is up to you.
Questions, if any, are best placed on the Discuss page.
To include your participation in each of these laboratories create a subpage of your user page once you register at wikiversity and use this subpage, for example, your online name/laboratory effort.
Enjoy learning by doing!
Hypotheses
- STAT5s have a role as downstream signal transducers in A1BG.
- A1BG is not transcribed by any STAT5s.
- STAT5s may assist transcription of A1BG by other transcription factors.
Introduction
{{free media}}
{{free media}}
{{fairuse}}
"STATs [signal transducers and activators of transcription] bind through their DNA-binding domain (DBD) to consensus elements (TTCTTGGAA, STAT5 consensus), resulting in gene transcription."[1]
Signal transducer and activator of transcription 5 (STAT5) actually consists of STAT5A (GeneID: ID: 6776) and STAT5B (GeneID: ID: 6777).
In the diagram on the right, STAT5 may be involved with an erythropoiesis receptor, or Epo Receptor. Murine, members of the subfamily Murinae, Epo Receptor truncations and known functions are included. Erythroid differentiation depends on transcriptional regulator GATA1, zinc finger DNA binding domain binds specifically to DNA consensus sequence [AT]GATA[AG] promoter elements. In erythropoiesis, EpoR is best known for inducing survival of progenitors.
The second down diagram on the right apparently describes the activation of STAT5.
The two live cell videos demonstrate that methylsulfonylmethane (MSM) suppresses breast cancer growth by down regulating STAT3 and STAT5b pathways.
Both "the 2.3 kb and the 160 bp proximal parts of the a1bg promoter direct sex-specific expression of the reporter gene, and that a negative regulatory element resides in the −1 kb to −160 bp region."[2]
"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative Stat5 sites and one [hepatic nuclear factor 6] HNF6/HNF3 binding site at −2077/−2069, −69/−61 and −137/−128 respectively [...]."[2]
The "GH-dependent sexually dimorphic expression conveyed by the 2.3 kb a1bg promoter is enhanced by the HNF6/HNF3 site and, if anything, reduced by the proximal Stat5 site in that the impact of the 3′Stat5 mutation was more pronounced in males."[2]
The "binding of Stat5 and HNF6 to the respective site by electromobility shift analysis (EMSA) [was verified] using female-derived [rat] liver nuclear extracts. [...] Stat5 bound to the a1bg proximal Stat5 site, 3′Stat5 and the mutated oligonucleotide was unable to compete for the binding. Similarly, HNF6 bound to the a1bg HNF6 oligonucleotide, but in this case, the mutated oligonucleotide was able to compete for binding when added in large excess [...]. However, [...] the HNF6 binding capacity of the mutated oligonucleotide was clearly reduced. A 20 molar excess of the mutated oligonucleotide had only a marginal effect on the binding of HNF6 [...], whereas a 20 molar excess of unlabelled probe [...] completely abolished binding. Supershift analysis with an HNF6 antibody revealed a complex with a slightly lower mobility than the HNF6 complex [...]. By extending the electrophoresis run and including nuclear extract from hypophysectomized rats, devoid of GH and thereby lacking HNF6 (Lahuna et al. 1997), the two different complexes were clearly visualized. The complex with the lower mobility is most probably due to the binding of HNF3, in analogy with what was shown by Lahuna et al. for the CYP2C12 HNF6 binding site; HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997). To summarize the EMSA results, Stat5 and HNF6 could bind to their respective site in the a1bg promoter in vitro, and the mutations introduced in respective site abolished binding of the corresponding factor."[2]
The "expression of a −116/−89 deletion construct in which also the HNF6 site was mutated, (−116/−89) delmutHNF6-Luc, [...] the generated luciferase activities were reduced in both sexes [...]. This is in contrast to that mutation/deletion of the sites separately only affected the expression in female livers."[2]
The "−116/−89 region contains a site(s) of importance for the GH-dependent and female-specific expression of the a1bg gene, and that the impact of this region together with the HNF6 site is more complex than mere enhancement of the expression in females."[2]
The "Stat5 site conveys expression of a1bg to higher extent in male than in female livers, thereby reducing the sex difference. [...] On the other hand, HNF6 is expressed at higher levels in female than in male rat liver (Lahuna et al. 1997). Indeed, following mutation of the HNF6-binding element, mutHNF6-Luc, the sex-differentiated expression was attenuated due to reduced expression in females. Thus, for a1bg, the sex-related difference in amount of HNF6 is likely to contribute to the sex-differentiated and female characteristic expression."[2]
Nuclear "proteins binding to the a1bg −116/−89 region [are] members of the [nuclear factor 1] NF1 and the [octamer transcription factor] Oct families of transcription factors. NF1 genes are expressed in most adult tissues (Osada et al. 1999). It is not known how NF1 modulates transcriptional activity, and both activation and repression of transcription have been reported (Gronostajski 2000). Cofactors such as CBP/p300 and HDAC have been shown to interact with NF1 proteins suggesting modulation of chromatin structure (Chaudhry et al. 1999). NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004). In addition to the HNF6, Stat5 and NF1/Oct sites, the a1bg promoter harbours an imperfect HNF4 site at −51/−39 with two mismatches compared with the HNF4 consensus site. HNF4 is clearly important for the expression of CYP2C12 (Sasaki et al. 1999), however, the −51/−39 region in a1bg was not protected in the footprinting analysis and was therefore not analysed further. Like NF1, Oct proteins have been reported to be involved in activation as well as repression of gene expression (Phillips & Luisi 2000). Stat5 has been shown to form a stable complex with Oct-1 (Magne et al. 2003). Moreover, NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."[2]
In the diagram on the right is liver "expression of a1bg-luciferase constructs. (A) Stat5 and HNF6 consensus sequences and corresponding sites in the 2.3 kb a1bg promoter alongside with the used mutations. (B) Female (black bars) and male (open bars) rats [results]."[2]
STAT5 consensus sequence is TTCXXXGAA, where X = A, C, or G.[2] Or, X = G or T.[1]
Core promoters
![](/images/0/08/Core_promoter_elements.png)
The core promoter is approximately -34 nts upstream from the TSS.
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
From the first nucleotide just before ZNF497 to the first nucleotide just before A1BG are 4300 nucleotides. The core promoter on this side of A1BG extends from approximately 4266 to the possible transcription start site at nucleotide number 4300.
Def. "the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter" is called the basal machinery, or basal transcription machinery.[4]
Proximal promoters
Def. a "promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.[12][13]"[5] is called a proximal promoter.
The proximal sequence upstream of the gene that tends to contain primary regulatory elements is a proximal promoter.
It is approximately 250 base pairs or nucleotides, nts, upstream of the transcription start site.
The proximal promoter begins about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
Distal promoters
The "upstream regions of the human CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene."[6]
"Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints."[7]
Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54)[8] or several regions of different lengths, many nucleotides away, such as (-2732 to -2600) and (-2830 to -2800).[9]
The "[d]istal promoter is not a spacer element."[10]
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460 in the negative direction and 2300 in the positive direction.
If there are any transcription factors between ZNF497 and A1BG, they are inside the gene for ZNF497 as there are only 858 nts between them. The data set in the ZNF497 positive direction has been extended to just beyond ZNF497.
STAT5 samplings
{{free media}}
Once you've decided on an entity, source, or object, compose a method, way, or procedure to explore it.
One way is to perceive (see, feel, hear, taste, or touch, for example) if there are more than one of them.
Ask some questions about it.
Does it appear to have a spatial extent?
Is there any change over time?
Can it be profiled with a kind of spectrum for example, by emitted radiation? Sample by plotting two or more apparent variables against each other, like intensity versus wavelength.
Is there some location, time, intensity, where there isn't one?
Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG.
Def. a series of chemical reactions within a cell which start when a transmembrane protein comes into contact with a chemical signal, resulting in a second messenger being triggered is called a signal transduction.
A transcription activator, or activator of transcription, may be a transcription factor that increases gene transcription, where most bind to enhancers or proximal promoter elements.
STAT5s may have a downstream proximal promoter element. "Downstream" can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS.
As is shown in the computer programming sampling is performed to 100 nts past the TSS.
Regarding hypotheses 2: A1BG is not transcribed by any STAT5s.
For the Basic programs (starting with SuccessablesSTAT5.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesSTAT5--.bas, looking for 3'-TTCNNNGAA-5', 0,
- positive strand in the negative direction is SuccessablesSTAT5+-.bas, looking for 3'-TTCNNNGAA-5', 2, 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782,
- negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesSTAT5-+.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCGGGAA-5', 4247,
- positive strand in the positive direction is SuccessablesSTAT5++.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCATGAA-5', 128,
- complement, negative strand, negative direction is SuccessablesSTAT5c--.bas, looking for 3'-AAGNNNCTT-5', 2, 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782,
- complement, negative strand, positive direction is SuccessablesSTAT5c-+.bas, looking for 3'-AAGNNNCTT-5', 1, 3'-AAGGTACTT-5', 128,
- complement, positive strand, negative direction is SuccessablesSTAT5c+-.bas, looking for 3'-AAGNNNCTT-5', 0,
- complement, positive strand, positive direction is SuccessablesSTAT5c++.bas, looking for 3'-AAGNNNCTT-5', 1, 3'-AAGGCCCTT-5', 4247,
- inverse complement, negative strand, negative direction is SuccessablesSTAT5ci--.bas, looking for 3'-TTCNNNGAA-5', 0,
- inverse complement, negative strand, positive direction is SuccessablesSTAT5ci-+.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCGGGAA-5', 4247,
- inverse complement, positive strand, negative direction is SuccessablesSTAT5ci+-.bas, looking for 3'-TTCNNNGAA-5', 2, 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782,
- inverse complement, positive strand, positive direction is SuccessablesSTAT5ci++.bas, looking for 3'-TTCNNNGAA-5', 1, 3'-TTCCATGAA-5', 128,
- inverse, negative strand, negative direction, is SuccessablesSTAT5i--.bas, looking for 3'-AAGNNNCTT-5', 2, 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782,
- inverse, negative strand, positive direction, is SuccessablesSTAT5i-+.bas, looking for 3'-AAGNNNCTT-5', 1, 3'-AAGGTACTT-5', 128,
- inverse, positive strand, negative direction, is SuccessablesSTAT5i+-.bas, looking for 3'-AAGNNNCTT-5', 0,
- inverse, positive strand, positive direction, is SuccessablesSTAT5i++.bas, looking for 3'-AAGNNNCTT-5', 1, 3'-AAGGCCCTT-5', 4247.
Regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors.
"NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004)."[2]
"NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."[2]
STAT5 (4560-2846) UTRs
- Positive strand, negative direction: 2, TTCCCTGAA at 3782, TTCGTTGAA at 3506.
STAT5 positive direction (4265-4050) proximal promoters
- Negative strand, positive direction: TTCCGGGAA at 4247.
STAT5 positive direction (4050-1) distal promoters
- Positive strand, positive direction: TTCCATGAA at 128.
STAT5 random dataset samplings
- STAT5r0: 0.
- STAT5r1: 3, TTCGCTGAA at 2712, TTCCCCGAA at 2455, TTCTCAGAA at 1534.
- STAT5r2: 0.
- STAT5r3: 1, TTCTTGGAA at 4224.
- STAT5r4: 2, TTCTCCGAA at 3875, TTCGCGGAA at 2553.
- STAT5r5: 2, TTCTCCGAA at 3383, TTCGTGGAA at 633.
- STAT5r6: 2, TTCGGAGAA at 4247, TTCTGGGAA at 1361.
- STAT5r7: 1, TTCAGCGAA at 3753.
- STAT5r8: 1, TTCCATGAA at 1472.
- STAT5r9: 2, TTCGTTGAA at 4241, TTCTATGAA at 2350.
STAT5r arbitrary (evens) (4560-2846) UTRs
- STAT5r4: TTCTCCGAA at 3875.
- STAT5r6: TTCGGAGAA at 4247.
STAT5r alternate (odds) (4560-2846) UTRs
- STAT5r3: TTCTTGGAA at 4224.
- STAT5r5: TTCTCCGAA at 3383.
- STAT5r7: TTCAGCGAA at 3753.
- STAT5r9: TTCGTTGAA at 4241.
STAT5r alternate negative direction (odds) (2811-2596) proximal promoters
- STAT5r1: TTCGCTGAA at 2712.
STAT5r arbitrary positive direction (odds) (4265-4050) proximal promoters
- STAT5r3: TTCTTGGAA at 4224.
- STAT5r9: TTCGTTGAA at 4241.
STAT5r alternate positive direction (evens) (4265-4050) proximal promoters
- STAT5r6: TTCGGAGAA at 4247.
STAT5r arbitrary negative direction (evens) (2596-1) distal promoters
- STAT5r4: TTCGCGGAA at 2553.
- STAT5r6: TTCTGGGAA at 1361.
STAT5r alternate negative direction (odds) (2596-1) distal promoters
- STAT5r1: TTCCCCGAA at 2455, TTCTCAGAA at 1534.
- STAT5r5: TTCGTGGAA at 633.
- STAT5r9: TTCTATGAA at 2350.
STAT5r arbitrary positive direction (odds) (4050-1) distal promoters
- STAT5r1: TTCGCTGAA at 2712, TTCCCCGAA at 2455, TTCTCAGAA at 1534.
- STAT5r5: TTCTCCGAA at 3383, TTCGTGGAA at 633.
- STAT5r7: TTCAGCGAA at 3753.
- STAT5r9: TTCTATGAA at 2350.
STAT5r alternate positive direction (evens) (4050-1) distal promoters
- STAT5r4: TTCTCCGAA at 3875, TTCGCGGAA at 2553.
- STAT5r6: TTCTGGGAA at 1361.
STAT5 analysis and results
STAT5 consensus sequence is TTCXXXGAA, where X = A, C, or G.[2] Or, X = G or T.[1] The inverse complement is the same as the direct.
Reals or randoms | Promoters | direction | Numbers | Strands | Occurrences | Averages (± 0.1) |
---|---|---|---|---|---|---|
Reals | UTR | negative | 2 | 2 | 1 | 1 ± 1 (--0,+2) |
Randoms | UTR | arbitrary negative | 2 | 10 | 0.2 | 0.3 |
Randoms | UTR | alternate negative | 4 | 10 | 0.4 | 0.3 |
Reals | Core | negative | 0 | 2 | 0 | 0 |
Randoms | Core | arbitrary negative | 0 | 10 | 0 | 0 |
Randoms | Core | alternate negative | 0 | 10 | 0 | 0 |
Reals | Core | positive | 0 | 2 | 0 | 0 |
Randoms | Core | arbitrary positive | 0 | 10 | 0 | 0 |
Randoms | Core | alternate positive | 0 | 10 | 0 | 0 |
Reals | Proximal | negative | 0 | 2 | 0 | 0 |
Randoms | Proximal | arbitrary negative | 0 | 10 | 0 | 0.05 |
Randoms | Proximal | alternate negative | 1 | 10 | 0.1 | 0.05 |
Reals | Proximal | positive | 1 | 2 | 0.5 | 0.5 ± 0.5 (-+1,++0) |
Randoms | Proximal | arbitrary positive | 2 | 10 | 0.2 | 0.15 |
Randoms | Proximal | alternate positive | 1 | 10 | 0.1 | 0.15 |
Reals | Distal | negative | 0 | 2 | 0 | 0 |
Randoms | Distal | arbitrary negative | 2 | 10 | 0.2 | 0.3 |
Randoms | Distal | alternate negative | 4 | 10 | 0.4 | 0.3 |
Reals | Distal | positive | 1 | 2 | 0.5 | 0.5 ± 0.5 (-+0,++1) |
Randoms | Distal | arbitrary positive | 7 | 10 | 0.7 | 0.5 |
Randoms | Distal | alternate positive | 3 | 10 | 0.3 | 0.5 |
Comparison:
The occurrences of real STAT5 UTRs, proximals and distals are greater than the randoms. This suggests that the real STAT5s are likely active or activable.
Verifications
To verify that your sampling has explored something, you may need a control group. Perhaps where, when, or without your entity, source, or object may serve.
Another verifier is reproducibility. Can you replicate something about your entity in your laboratory more than 3 times. Five times is usually a beginning number to provide statistics (data) about it.
For an apparent one time or perception event, document or record as much information coincident as possible. Was there a butterfly nearby?
Has anyone else perceived the entity and recorded something about it?
Gene ID: 1, includes the nucleotides between neighboring genes and A1BG. These nucleotides can be loaded into files from either gene toward A1BG, and from template and coding strands. These nucleotide sequences can be found in Gene transcriptions/A1BG. Copying the above discovered STAT5s and putting the sequences in "⌘F" locates these sequences in the same nucleotide positions as found by the computer programs.
Core promoters STAT5s
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
There are no STAT5s in the core promoter between 4425 and 4460.
From the first nucleotide just before ZNF497 to the first nucleotide just before A1BG are 4300 nucleotides. The core promoter on this side of A1BG extends from approximately 4266 to the possible transcription start site at nucleotide number 4300.
There are no STAT5s in the core promoter between 4266 and 4300. But there is one at 3'-TTCCGGGAA-5', 4247.
Proximal promoter STAT5s
The proximal promoter begins about nucleotide number 4210 in the negative direction.
There are no STAT5s in the proximal promoter between 4210 and 4460.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
There is one STAT5 in the proximal promoter between 4050 and 4300, 3'-TTCCGGGAA-5' at 4247.
Distal promoter STAT5s
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.
There are the following STAT5s on the positive strand, negative direction: 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782.
And, their complements on the negative strand, negative direction: 3'-AAGCAACTT-5', 3506, 3'-AAGGGACTT-5', 3782.
Distal STAT5s in the positive direction are not inside ZNF497.
Transcribed STAT5s
"The locations of [nuclear factor I] NFI-binding sites, [glucocorticoid response elements] GREs, and [mammary gland factor] MGF (STAT5)-binding sites in the distal promoter region are as described in references 28 and 29. The underlined nucleotides indicate the palindromic nature of the MGF-binding sites."[11]
Prolactin (PRL), "via Jak2, induces binding of Stat5 to a distal GAS site (GAS1) in the cyclin D1 promoter."[12]
"We defined a second PRL-responsive region spanning −254 to −180 that contains a second GAS site (GAS2) and an Oct-1 binding site. Although mutational analysis indicated independence from GAS2, proximal promoter activity remained Stat5-dependent, suggesting alternative mechanisms. EMSA showed that Oct-1 binds the −254 to −180 region and that PRL decreased Oct-1 binding, leading to increased PRL-responsiveness of the proximal cyclin D1 promoter in multiple cell lines."[12]
"The distal region (−830 to −720 bp) of the rat whey acidic protein (WAP) gene contains a composite response element (CoRE), which has been demonstrated previously to confer mammary gland-specific and hormonally regulated WAP gene expression. Point mutations in the binding sites for specific transcription factors present within this CoRE have demonstrated the importance of both nuclear factor I (NFI) and STAT5 as well as cooperative interactions with the glucocorticoid receptor (GR) in the regulation of WAP gene expression in the mammary gland of transgenic mice."[13]
"Within this distal region we found a Stat5-like motif, and in vitro DNA binding assays as well as in vivo chromosomal immunoprecipitation assays showed [interleukin-2] IL-2-induced binding of both Stat5a and Stat5b to this distal element in the [Interferon-γ] IFNG gene."[14]
Progesterone receptor (PR), "PR binding to the distal promoter region depends on the [Janus kinase] JAK/STAT pathway activation by progestin and on the recruitment of STAT5A to the same region, while PR recruitment to the proximal promoter region involves DNA direct receptor binding."[15]
"The methylation-sensitive regions within IL10 intron 4 and the distal promoter of IL13 both contain potential Sp1, AP-2, and STAT5 binding sites predicted using bioinformatics software Matinspector and PROSCAN (Version 1.7)."[16]
Laboratory reports
Below is an outline for sections of a report, paper, manuscript, log book entry, or lab book entry. You may create your own, of course.
STAT5 transcription laboratory
by --Marshallsumter (discuss • contribs) 02:47, 28 October 2017 (UTC)
Abstract
Three hypotheses have been examined: (1) STAT5s have a role as downstream signal transducers in A1BG, (2) alpha-1-B glycoprotein (A1BG) is not transcribed by any STAT5s, and (3) STAT5s may assist transcription of A1BG by other transcription factors. These have been tested by literature searching articles that report STAT5s in the promoter region of a particular human gene and by using a simple computer program to look for STAT5s in the nucleotide sequences on either side of the A1BG gene. Both the template DNA strand and the coding strand have been checked. To show that these STAT5s can be used during or for transcription of A1BG at least one transcription factor has been found.
Introduction
According to one source, A1BG is transcribed from the direction of ZNF497: 3' - 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5', per Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, and Y. Paul Goldberg, Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same, US Patent Office, July 29, 2004, at http://www.google.com/patents?hl=en&lr=&vid=USPATAPP10416914&id=7iaVAAAAEBAJ&oi=fnd&printsec=abstract#v=onepage&q&f=false where the second 'G' at left of four Gs in a row is the TSS. Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.
Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins. These inhibit the toxic effect of snake venom metalloproteinases or myotoxins and protect the animal from envenomation.[17]
Many transcription factors (TFs) may occur upstream and occasionally downstream of the transcription start site (TSS), in this gene's promoter. The following have been examined so far: (1) AGC boxes (GCC boxes), (2) CArG boxes, (3) enhancer boxes, (4) HY boxes, and (5) metal responsive elements (MREs).
An AGC box was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG.
A full web search produced several references including a GeneCard[18] for "zinc finger protein 497" and "GCC box", including "May be involved in transcriptional regulation."[18] Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG.
By combining a literature search with computer analysis of each promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, CArG boxes have been found. To show that these CArG boxes may be used during or for transcription of A1BG at least one transcription factor has been affirmed.
A literature search of more recent results discovered: "Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [. Three] other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."[19]
These together with the core motif CC(A/T)6GG suggest a more general CArG-box motif of (C(C/A/T)(A/T)6(A/G)G). Subsequent computer-program testing revealed two more general CArG boxes: 3'-CAAAAAAAAG-5' at 1399 nts from ZSCAN22 and 3'-CATTAAAAGG-5' at 3441 nts from ZSCAN22, but none within 958 nts toward A1BG from ZNF497.
These results show that the presence of CArG boxes on the ZSCAN22 side of A1BG implies their use when transcribing A1BG, although they may be pointing toward ZSCAN22. These suggest that the hypothesis (A1BG is not transcribed by a CArG box) is false. Regarding the second hypothesis (The lack of a CArG box on either side of A1BG does not prove that it is not actively used to transcribe A1BG), the presence of more general CArG boxes in the distal promoter tentatively confirms this hypothesis.
CArG boxes do occur in the distal promoter of A1BG. And, it is likely that a CArG box is involved in some way with the transcription of A1BG.
The presence of many enhancer boxes on both sides of A1BG demonstrate that the hypothesis: "A1BG is not transcribed by an enhancer box", is false.
The finding by literature search of evidence verifying that at least one transcription factor can enhance or inhibit the transcription of A1BG using one or more enhancer boxes disproves the hypothesis: "Existence of an enhancer box on either side of A1BG does not prove that it is actively used to transcribe A1BG".
Enhancer boxes do occur in the proximal and distal promoters of A1BG. And, it is likely that an enhancer box is involved in some way with the transcription of A1BG.
HY boxes were not found in either core promoters or the proximal promoters in either direction. However, HY boxes were found in the distal promoters between ZSCAN22 and A1BG. No genes are described in the literature so far as transcribed from HY boxes in any distal promoters.
Either A1BG can be transcribed by HY boxes in the distal promoter, or A1BG is not transcribed by HY boxes. As the literature appears absent from a Google Scholar advanced search to confirm possible transcription from distal promoters, wet chemistry experiments are needed to test the possibility.
By combining a literature search with computer analysis of the promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, metal responsive elements have been found. Literature search has also discovered at least three post-translational isoforms including the unaltered precursor. Although no metal responsive elements overlap any enhancer boxes in the distal promoter, there are elements in the distal promoter.
"The human genome is estimated to contain 700 zinc-finger genes, which perform many key functions, including regulating transcription. [Four] clusters of zinc-finger genes [occur] on human chromosome 19".[20]
Nearby zinc-fingers on chromosome 19 include ZNF497 (GeneID: 162968), ZNF837 (GeneID: 116412), and ZNF8 (GeneID: 7554).
"In rodents and in humans, about one third of the zinc-finger genes carry the Krüppel-associated box (KRAB), a potent repressor of transcription (Margolin et al. 1994), [...]. There are more than 200 KRAB-containing zinc-finger genes in the human genome, about 40% of which reside on chromosome 19 and show a clustered organization suggesting an evolutionary history of duplication events (Dehal et al. 2001)."[20]
ZNF8 is in cluster V along with A1BG.[20]
"In contrast to the four clusters considered [I through IV], one that occurs at the telomere of chromosome 19, which we will call cluster V, has been very stable [over mouse, rat, and human]."[20]
"Apart from the somewhat unexpected location of Zfp35 on mouse chromosome 18 and of the AIBG orthologs on mouse chromosome 15 and rat chromosome 7, there has been little rearrangement."[20]
So far no article has reported any linkage between zinc, including various zinc fingers, or cadmium, and A1BG.
Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."[21]
"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."[22]
Pharmacogenomic variants have been reported. There are A1BG genotypes.[23]
A1BG has a genetic risk score of rs893184.[23]
"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10−5)."[23]
"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."[23]
For example, GeneID: 9 has isoforms: a, b, X1, and X2. Each of these (a and b) have variants. Variants 1-6 and 9 all encode the same isoform (a).
Variants 7, 8 and 10 all encode isoform b. Isoforms X1 and X2 are predicted.
Variants can differ in promoters, untranslated regions, or exons. For GeneID: 9: This variant (1) represents the longest transcript but encodes the shorter isoform (a). This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (2, also known as Type IID) lacks an alternate exon in the 5' UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (9, also known as Type IA) has a distinct 5' UTR and represents use of an alternate promoter known as the NATa or P3 promoter, compared to variant 1.
But, A1BG in NCBI Gene lists only one isoform, the gene locus itself, and the protein transcribed is a precursor subject to translational or more likely post-translational modifications.
The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG.
It isn't known which, if any, assist in locating and affixing the transcription mechanism for A1BG. This examination is the first to test one such DNA-occurring TF: the STAT5s.
Experiments
Computer programs were written and run on the positive and negative strands between ZSCAN22 or ZNF497 and A1BG.
Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG.
STAT5s may have a downstream proximal promoter element if the computer nts sampling is additionally, approximately at least 250 nts downstream of the transcription start site. "Downstream" can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. The computer programs written to test for STAT5 promoters were limited to 100 nts below the apparent TSSs.
Regarding hypotheses 2: A1BG is not transcribed by any STAT5s.
Here, the experiments have two parts: (1) are there any STAT5 promoters? and (2) are any of these used to transcribe A1BG?
The Basic programs (starting with SuccessablesSTAT5.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+) looking for 16 possible types of promoters.
Regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors.
An extensive literature search was performed to find even one example of a STAT5 assist of an A1BG transcription.
Results
Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG.
(1) "Downstream" can refer to downstream from an enhancer but before the transcription start site.
There is a STAT5 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3'-TTCCGGGAA-5' at 4247 in the proximal promoter, where the TSS is at 4300 nts from ZNF497.
There is no such "downstream" promoter between ZSCAN22 and A1BG.
(2) "Downstream from a TATA box or an initiator element (Inr) but before the transcription start site (TSS).
Both a TATA box or an Inr are within the core promoter. There are no STAT5s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG.
(3) "Downstream from another promoter element and containing the TSS. There are no STAT5s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG containing either TSS.
(4) "Downstream after the TSS. No STAT5s were detected at least to 100 nts downstream of each TSS.
Regarding hypotheses 2: A1BG is not transcribed by any STAT5s.
There is a STAT5 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3'-TTCCGGGAA-5' at 4246 in the proximal promoter, where the TSS is at 4300 nts from ZNF497. This direction is the only confirmed transcription of A1BG; therefore, it is likely A1BG is transcribed using this STAT5 transcription factor.
There are two STAT5s on the negative strand in the negative direction, 3'-AAGCAACTT-5' at 3506 and 3'-AAGGGACTT-5' at 3782. Both of these are in the distal promoter between ZSCAN22 and A1BG.
Regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors.
{{fairuse}}
Both "the 2.3 kb and the 160 bp proximal parts of the a1bg promoter direct sex-specific expression of the reporter gene, and that a negative regulatory element resides in the −1 kb to −160 bp region."[2]
"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative Stat5 sites and one [hepatic nuclear factor 6] HNF6/HNF3 binding site at −2077/−2069, −69/−61 and −137/−128 respectively [...]."[2]
The "GH-dependent sexually dimorphic expression conveyed by the 2.3 kb a1bg promoter is enhanced by the HNF6/HNF3 site and, if anything, reduced by the proximal Stat5 site in that the impact of the 3′Stat5 mutation was more pronounced in males."[2]
The "binding of Stat5 and HNF6 to the respective site by electromobility shift analysis (EMSA) [was verified] using female-derived [rat] liver nuclear extracts. [...] Stat5 bound to the a1bg proximal Stat5 site, 3′Stat5 and the mutated oligonucleotide was unable to compete for the binding. Similarly, HNF6 bound to the a1bg HNF6 oligonucleotide, but in this case, the mutated oligonucleotide was able to compete for binding when added in large excess [...]. However, [...] the HNF6 binding capacity of the mutated oligonucleotide was clearly reduced. A 20 molar excess of the mutated oligonucleotide had only a marginal effect on the binding of HNF6 [...], whereas a 20 molar excess of unlabelled probe [...] completely abolished binding. Supershift analysis with an HNF6 antibody revealed a complex with a slightly lower mobility than the HNF6 complex [...]. By extending the electrophoresis run and including nuclear extract from hypophysectomized rats, devoid of GH and thereby lacking HNF6 (Lahuna et al. 1997), the two different complexes were clearly visualized. The complex with the lower mobility is most probably due to the binding of HNF3, in analogy with what was shown by Lahuna et al. for the CYP2C12 HNF6 binding site; HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997). To summarize the EMSA results, Stat5 and HNF6 could bind to their respective site in the a1bg promoter in vitro, and the mutations introduced in respective site abolished binding of the corresponding factor."[2]
The "expression of a −116/−89 deletion construct in which also the HNF6 site was mutated, (−116/−89) delmutHNF6-Luc, [...] the generated luciferase activities were reduced in both sexes [...]. This is in contrast to that mutation/deletion of the sites separately only affected the expression in female livers."[2]
The "−116/−89 region contains a site(s) of importance for the GH-dependent and female-specific expression of the a1bg gene, and that the impact of this region together with the HNF6 site is more complex than mere enhancement of the expression in females."[2]
The "Stat5 site conveys expression of a1bg to higher extent in male than in female livers, thereby reducing the sex difference. [...] On the other hand, HNF6 is expressed at higher levels in female than in male rat liver (Lahuna et al. 1997). Indeed, following mutation of the HNF6-binding element, mutHNF6-Luc, the sex-differentiated expression was attenuated due to reduced expression in females. Thus, for a1bg, the sex-related difference in amount of HNF6 is likely to contribute to the sex-differentiated and female characteristic expression."[2]
Nuclear "proteins binding to the a1bg −116/−89 region [are] members of the [nuclear factor 1] NF1 and the [octamer transcription factor] Oct families of transcription factors. NF1 genes are expressed in most adult tissues (Osada et al. 1999). It is not known how NF1 modulates transcriptional activity, and both activation and repression of transcription have been reported (Gronostajski 2000). Cofactors such as CBP/p300 and HDAC have been shown to interact with NF1 proteins suggesting modulation of chromatin structure (Chaudhry et al. 1999). NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004). In addition to the HNF6, Stat5 and NF1/Oct sites, the a1bg promoter harbours an imperfect HNF4 site at −51/−39 with two mismatches compared with the HNF4 consensus site. HNF4 is clearly important for the expression of CYP2C12 (Sasaki et al. 1999), however, the −51/−39 region in a1bg was not protected in the footprinting analysis and was therefore not analysed further. Like NF1, Oct proteins have been reported to be involved in activation as well as repression of gene expression (Phillips & Luisi 2000). Stat5 has been shown to form a stable complex with Oct-1 (Magne et al. 2003). Moreover, NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."[2]
In the diagram on the right is liver "expression of a1bg-luciferase constructs. (A) Stat5 and HNF6 consensus sequences and corresponding sites in the 2.3 kb a1bg promoter alongside with the used mutations. (B) Female (black bars) and male (open bars) rats [results]."[2]
The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.
The STAT5 promoter on the other side (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the STAT5 on the ZSCAN22 side to be used in analogy to the rat. Distal STAT5s in the positive direction are not inside ZNF497.
Discussion
Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG.
The only known TSS for A1BG lies at 4300 nts from ZNF497 toward A1BG. A STAT5 transcription site lies at 3'-TTCCGGGAA-5' at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.
"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed [a] Stat5 [site] at [...] −69/−61 [...]."[2]
The murine downstream promoter element is only 11 nts displaced from the human one. This suggests a STAT5 participation in human gene transcription of A1BG.
Regarding hypothesis 2: A1BG is not transcribed by any STAT5s.
"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative Stat5 sites [...] at −2077/−2069 [and] −69/−61 [...]."[2]
There are two STAT5s on the negative strand in the negative direction, 3'-AAGCAACTT-5' at 3506 (-954) and 3'-AAGGGACTT-5' at 3782 (-678) in the distal promoter between ZSCAN22 and A1BG. Although much closer than their likely murine counterparts, they are on the other side of A1BG from the STAT5 site confirming hypothesis 1. If active in humans or murine-like STAT5s occur within or beyond ZNF497 in this distal promoter, then human A1BG is transcribed using STAT5 promoters disproving hypothesis 2.
A Google Scholar search using ZNF497 with STAT5 found no articles discussing STAT5 sites inside or associated with ZNF497. To confirm they exist, a data file going say 3,000 nts away from A1BG into ZNF497 needs to be created and tested for a distal promoter on this side. The extended data set went 4,300 nts away from A1BG into ZNF497
Regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors.
Literature search has found that STAT5s assist transcription of A1BG by other transcription factors.[2] The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[2]
Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for
- CArG boxes,
- Enhancer boxes,
- HY boxes and
- MREs.
The STAT5 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the STAT5 on the ZSCAN22 side to be used in analogy to the STAT5 on the same side as in the rat.[2]
A STAT5 transcription site lies at 3'-TTCCGGGAA-5' at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.
Conclusions
All three hypotheses have been addressed. Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a STAT5 participation in human gene transcription of A1BG in the proximal promoter downstream between any other promoter and the TSS on the ZNF497 side of A1BG. Regarding hypothesis 2: A1BG is not transcribed by any STAT5s is clearly disproved by the STAT5 transcription factor in the proximal promoter on the ZNF497 side of A1BG. And, regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors, literature search has found that STAT5s assist transcription of A1BG by other transcription factors.[2] The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[2] A STAT5 transcription site lies at 3'-TTCCGGGAA-5' at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.
Laboratory evaluations
To assess your example, including your justification, analysis and discussion, I will provide such an assessment of my example for comparison and consideration.
Evaluation
No wet chemistry experiments were performed to confirm that Gene ID: 1 is transcribed from either side using STAT5s, especially in the distal promoters. The NCBI database is generalized, whereas individual human genome testing could demonstrate that A1BG is transcribed from either side. It would be a good check to add sufficient nts to the data sets for the ZNF497 side to confirm transcription of A1BG per analogy to the rat.
See also
- A1BG gene transcription core promoters
- A1BG gene transcriptions
- A1BG regulatory elements and regions
- A1BG response element negative results
- A1BG response element positive results
- AGC box transcription laboratory
- CArG box transcription laboratory
- Complex locus A1BG and ZNF497
- Enhancer box transcription laboratory
- HY box transcription laboratory
- Metal responsive elements laboratory
References
- ↑ 1.0 1.1 1.2 Corinne M. Silva (2004). "Role of STATs as downstream signal transducers in Src family kinase-mediated tumorigenesis" (PDF). Oncogene. 23: 8017–8023. Retrieved 2017-09-02.
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 Cissi Gardmo and Agneta Mode (1 December 2006). "In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression". Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. Retrieved 2017-09-01.
- ↑ Jennifer E.F. Butler, James T. Kadonaga (October 15, 2002). "The RNA polymerase II core promoter: a key component in the regulation of gene expression". Genes & Development. 16 (20): 2583–292. doi:10.1101/gad.1026202. PMID 12381658.
- ↑ Stephen T. Smale and James T. Kadonaga (July 2003). "The RNA Polymerase II Core Promoter" (PDF). Annual Review of Biochemistry. 72 (1): 449–79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved 2012-05-07.
- ↑ Thomas Shafee and Rohan Lowe (9 March 2017). "Eukaryotic and prokaryotic gene structure" (PDF). WikiJournal of Medicine. 4 (1): 2. doi:10.15347/wjm/2017.002. Retrieved 2017-04-06.
- ↑ Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura (1 July 1994). "Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters". The Journal of Biochemistry. 116 (1): 193–203. doi:10.1093/oxfordjournals.jbchem.a124493. Retrieved 2017-08-16.
- ↑ Michelle Craig Barton, Navid Madani, and Beverly M. Emerson (8 July 1997). "Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro". Proceedings of the National Academy of Sciences of the United States of America. 94 (14): 7257–62. Retrieved 2017-08-16.
- ↑ A Aoyama, T Tamura, K Mikoshiba (March 1990). "Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter". Biochemical and Biophysical Research Communications. 167 (2): 648–53. doi:10.1016/0006-291X(90)92074-A. Retrieved 2012-12-13.
- ↑ J Gao and L Tseng (June 1996). "Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells". Molecular Endocrinology. 10 (6): 613–21. doi:10.1210/me.10.6.613. Retrieved 2012-12-13.
- ↑ Peter Pasceri, Dylan Pannell, Xiumei Wu, and James Ellis (July 15, 1998). "Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences". Blood. 92 (2): 653–63. Retrieved 2012-12-13.
- ↑ S Li and JM Rosen (April 1995). "Nuclear factor I and mammary gland factor (STAT5) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice" (PDF). Molecular and Cellular Biology. 15 (4): 2063–70. doi:10.1128/MCB.15.4.2063. Retrieved 2017-10-27.
- ↑ 12.0 12.1 Jennifer L. Brockman and Linda A. Schuler (15 July 2005). "Prolactin signals via Stat5 and Oct-1 to the proximal cyclin D1 promoter". Molecular and Cellular Endocrinology. 239 (1–2): 45–53. Retrieved 2017-10-27.
- ↑ Sudit S. Mukhopadhyay, Shannon L. Wyszomierski, Richard M. Gronostajski, and Jeffrey M. Rosen (October 2001). "Differential Interactions of Specific Nuclear Factor I Isoforms with the Glucocorticoid Receptor and STAT5 in the Cooperative Regulation of WAP Gene Transcription". Molecular and Cellular Biology. 21 (20): 6859–69. doi:10.1128/MCB.21.20.6859-6869.2001. Retrieved 2017-10-27.
- ↑ Jay H. Bream, Deborah L. Hodge, Rivkah Gonsky, Rosanne Spolski, Warren J. Leonard, Stephanie Krebs, Stephan Targan, Akio Morinobu, John J. O'Shea and Howard A. Young (24 September 2004). "A distal region in the interferon-γ gene is a site of epigenetic remodeling and transcriptional regulation by interleukin-2". Journal of Biological Chemistry. 279: 41249–57. doi:10.1074/jbc.M401168200. Retrieved 2017-10-27.
- ↑ Alicia Subtil-Rodríguez, Lluís Millán-Ariño, Ignacio Quiles, Cecilia Ballaré, Miguel Beato and Albert Jordan (June 2008). "Progesterone Induction of the 11β-Hydroxysteroid Dehydrogenase Type 2 Promoter in Breast Cancer Cells Involves Coordinated Recruitment of STAT5A and Progesterone Receptor to a Distal Enhancer and Polymerase Tracking". Molecular and Cellular Biology. 28 (11): 3830–49. doi:10.1128/MCB.01217-07. Retrieved 2017-10-27.
- ↑ Ming Zhao, Jinling Tang, Fei Gao, Xiaoyan Wu, Yunsheng Liang, Heng Yin, and Qianjin Lu (September 2010). "Hypomethylation of IL10 and IL13 Promoters in CD4" (PDF). Journal of Biomedicine and Biotechnology. 2010 (9): 31018–16. doi:10.1155/2010/931018. Retrieved 2017-10-27.
- ↑ Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.
- ↑ 18.0 18.1 Weizmann Institute of Science (2017). "Zinc Finger Protein 497". Israel: Weizmann Institute of Science. Retrieved 2017-08-20.
- ↑ Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis (19 April 2011). "FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis". Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17.
- ↑ 20.0 20.1 20.2 20.3 20.4 Deena Schmidt and Rick Durrett (1 December 2004). "Adaptive Evolution Drives the Diversification of Zinc-Finger Binding Domains". Molecular Biology and Evolution. 21 (12): 2326–2339. doi:10.1093/molbev/msh246. Retrieved 2017-10-16.
- ↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG". Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
- ↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). "Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice". Biochimica et Biophysica Acta (BBA) - General Subjects. 1770 (1): 79–86. Retrieved 2017-10-08.
- ↑ 23.0 23.1 23.2 23.3 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, Julie A. Johnson (June 2013). "Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes" (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.