Hsf1p gene transcriptions

Jump to navigation Jump to search

Associate Editor(s)-in-Chief: Henry A. Hoff

"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In Saccharomyces cerevisiae, this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."[1]

"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."[1]

Human genes

"In response to heat shock, mammalian HSF undergoes nuclear localization, trimerizes, and binds to HSEs."[1]

Interactions

Consensus sequences

The upstream activating sequence (UAS) for the Hsf1p is 5'-NGAAN-3' or 5'-(A/C/G/T)GAA(A/C/G/T)-3'.[2]

Complement-inverse copies

Recent "studies on the MDJ1 promoter identified a novel non-consensus HSE that consists of three separated nGAAn motifs, nTTCn-(11-bp)-nGAAn-(5-bp)-nGAAn (58). When we analyzed promoters of the genes induced by HSF for this non-consensus HSE, we found 2.9% of the genes contained this novel HSE."[1]

"Of the 90 heat-induced genes that contain HSEs in their promoters, there is an equal number of HSEs that start with nGAAn and nTTCn, but genes with a -fold change >5-fold have HSEs with the sequences nTTCnnGAAn or nTTCnnNNNnnTTC than any combination starting with nGAAn (66.7%). These findings suggest that the type of Hsf1 binding site is not as important as the topology of the HSE. Previous studies have revealed that all three DNA-binding domains of the trimeric Hsf1 bind to one face of the DNA (59), and our studies confirm that the orientation of the HSE with respect to the transcriptional start site can affect its transcriptional activity."[1]

Complement copies

"To identify Hsf1 binding sites in the promoter sequences, we analyzed 1000 bp upstream of the start codon of the loci that represented verifiable [open reading frame] ORFs. Sequences were retrieved from the [Saccharomyces Genome Database] SGD (36, 37) and analyzed using a simple pattern-identification program. We defined three types of HSEs, each having three nGAAn repeats in Perfect (PFT), GAP (GAP), and STEP (STP) arrangements. The perfect HSE (PFT) consists of three contiguous, inverted repeats of the nGAAn sequence, either nGAAnnTTCnnGAAn or nTTCnnGAAnnTTCn. The GAP HSE consists of an nGAAn repeat, followed by any 5 bp and 2 inverted nGAAn repeats (nGAAn-(5-bp)-nGAAnnTTCn) and its complement (nGAAnnTTCn-(5-bp)-nTTCn), as well as the related sequences nTTCn-(5-bp)-nTTCnnGAAn and nTTC-nnGAAn-(5-bp)-nGAAn. The STP HSE has a 5-bp insert between each of the 3 nGAAn repeats, yielding the sequences nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn and nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn (30). As per previous studies (27, 30), we also allowed a single mismatch (nGAR) in one of the three nGAAn repeats for PFT or GAP."[1]

Inverse copies

"HSEs are composed of inverted, alternating repeats of the 5-bp sequence nGAAn, where n is any nucleotide (53, 54, 55, 56). The number of pentameric units in an HSE varies, but three to six units are thought to be required for heat regulation in vivo (30, 57). Deviations from the consensus in both sequence and/or the distance between the modules can be tolerated, but to what extent is unknown. To determine if there is a correlation between the different HSEs and the affinity of Hsf1 for the motif and, thereby, the level of transcription activation, we searched in the promoters of the genes for three types of HSEs. Each type contains three nGAAn core motifs, but the variants are distinguishable from each other by the location of the core motifs within the HSE [...]."[1]

Hypotheses

  1. A1BG has no Hsf1s in either promoter.
  2. A1BG is not transcribed by an Hsf1.
  3. No Hsf1s participates in the transcription of A1BG.

HSE (Tang) samplings

Copying 5'-TGAAA-3' in "⌘F" yields twelve between ZSCAN22 and A1BG and 5'-CGAAC-3' one between ZNF497 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence NGAAN (starting with SuccessablesAAA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for NGAAN, 52, AGAAG at 4528, TGAAA at 4461, AGAAT at 4406, CGAAC at 4293, TGAAC at 4267, CGAAC at 4187, TGAAT at 4162, TGAAC at 4011, TGAAA at 3984, AGAAC at 3792, CGAAG at 3776, GGAAC at 3570, AGAAG at 3553, CGAAC at 3400, TGAAC at 3241, TGAAC at 3102, TGAAA at 3075, TGAAA at 3018, CGAAT at 2935, TGAAC at 2920, CGAAC at 2713, TGAAC at 2579, TGAAA at 2552, CGAAC at 2378, TGAAA at 2216, TGAAC at 2126, TGAAA at 2099, CGAAC at 1972, TGAAC at 1926, TGAAA at 1790, AGAAA at 1733, TGAAA at 1687, AGAAC at 1648, TGAAC at 1618, AGAAC at 1606, TGAAT at 1545, AGAAA at 1418, TGAAC at 1299, TGAAA at 1145, TGAAG at 1053, CGAAC at 1008, CGAAC at 842, TGAAA at 681, GGAAG at 619, TGAAA at 545, TGAAA at 408, AGAAA at 347, TGAAC at 327, GGAAT at 317, AGAAC at 280, AGAAA at 47, AGAAA at 25.
  2. negative strand, positive direction, looking for NGAAN, 62, GGAAC at 4443, GGAAG at 4263, GGAAG at 4248, AGAAG at 4197, TGAAA at 4091, AGAAC at 4067, AGAAC at 4047, TGAAC at 3936, TGAAA at 3926, AGAAA at 3918, GGAAG at 3871, GGAAC at 3855, AGAAG at 3851, TGAAC at 3837, AGAAT at 3833, GGAAA at 3794, TGAAT at 3780, GGAAG at 3762, GGAAG at 3667, TGAAA at 3596, GGAAT at 3565, TGAAT at 3443, GGAAT at 3439, GGAAT at 3365, AGAAG at 3216, GGAAA at 3165, AGAAC at 3093, AGAAT at 3067, TGAAA at 2917, AGAAT at 2839, GGAAA at 2831, GGAAG at 2784, AGAAC at 2775, GGAAG at 2748, AGAAT at 2723, AGAAA at 2629, GGAAA at 2623, GGAAC at 2578, AGAAT at 2241, AGAAC at 2224, AGAAG at 2192, TGAAA at 2146, AGAAC at 1950, AGAAC at 1810, AGAAG at 1633, GGAAG at 1594, AGAAT at 1418, AGAAT at 1318, AGAAG at 1231, GGAAA at 1089, AGAAG at 1063, TGAAG at 961, TGAAG at 861, CGAAG at 768, TGAAG at 727, AGAAG at 643, AGAAG at 559, CGAAC at 362, GGAAA at 290, TGAAG at 232, GGAAG at 209, AGAAG at 48.
  3. positive strand, negative direction, looking for NGAAN, 93, GGAAT at 4553, AGAAC at 4450, AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAG at 3936, TGAAA at 3922, GGAAG at 3909, TGAAC at 3783, GGAAC at 3723, GGAAT at 3677, AGAAC at 3667, GGAAA at 3663, GGAAG at 3610, AGAAA at 3591, TGAAA at 3507, GGAAC at 3459, AGAAG at 3407, AGAAA at 3376, AGAAA at 3342, TGAAC at 3244, AGAAT at 3235, TGAAA at 3146, AGAAT at 3002, GGAAA at 2967, GGAAA at 2957, GGAAA at 2926, AGAAA at 2838, AGAAA at 2831, AGAAG at 2828, AGAAA at 2821, AGAAA at 2814, AGAAG at 2811, AGAAA at 2804, AGAAA at 2800, TGAAA at 2746, GGAAG at 2730, TGAAC at 2716, TGAAT at 2707, TGAAA at 2619, TGAAG at 2595, GGAAG at 2557, AGAAA at 2505, GGAAA at 2458, TGAAC at 2381, AGAAT at 2372, TGAAA at 2282, CGAAA at 2157, AGAAA at 2055, TGAAC at 1955, AGAAT at 1946, TGAAA at 1855, GGAAT at 1693, GGAAC at 1684, GGAAA at 1676, GGAAA at 1660, AGAAG at 1655, GGAAA at 1642, AGAAA at 1630, TGAAA at 1625, TGAAA at 1582, CGAAG at 1555, AGAAC at 1551, AGAAT at 1520, AGAAT at 1413, TGAAC at 1302, AGAAT at 1293, TGAAA at 1212, TGAAC at 1011, AGAAT at 1002, TGAAC at 845, AGAAT at 836, CGAAA at 494, TGAAA at 473, TGAAG at 367, AGAAA at 357, GGAAG at 331, CGAAA at 312, AGAAA at 303, AGAAT at 291, AGAAC at 286, GGAAG at 241, AGAAA at 226, AGAAT at 196, AGAAA at 135, TGAAG at 132, TGAAA at 126, AGAAA at 102, GGAAG at 81, AGAAA at 52, TGAAT at 19.
  4. positive strand, positive direction, looking for NGAAN, 64, AGAAC at 4388, AGAAA at 4382, GGAAC at 4299, GGAAG at 4241, GGAAA at 4207, AGAAC at 4130, GGAAG at 4061, TGAAC at 4015, CGAAG at 3994, GGAAA at 3945, AGAAA at 3397, AGAAG at 3394, GGAAC at 3373, GGAAG at 3312, AGAAG at 3247, AGAAG at 3057, TGAAG at 3031, GGAAC at 3001, TGAAG at 2947, GGAAT at 2763, TGAAC at 2741, AGAAA at 2585, GGAAG at 2582, TGAAC at 2418, AGAAT at 2364, TGAAG at 2361, AGAAA at 2278, TGAAA at 2273, CGAAA at 2163, TGAAG at 2107, CGAAG at 2095, AGAAA at 1981, TGAAG at 1914, AGAAT at 1886, GGAAA at 1830, GGAAC at 1798, TGAAA at 1746, GGAAA at 1599, CGAAC at 1578, AGAAT at 1537, GGAAG at 1516, GGAAG at 1432, GGAAG at 1405, GGAAG at 1332, GGAAG at 1305, GGAAG at 1264, CGAAA at 1179, GGAAG at 1153, CGAAA at 1095, GGAAG at 1069, GGAAG at 1012, GGAAG at 928, GGAAG at 828, GGAAG at 760, GGAAG at 733, GGAAG at 676, CGAAC at 654, GGAAG at 592, TGAAC at 526, AGAAT at 522, GGAAG at 456, GGAAA at 134, TGAAC at 129, AGAAA at 110.
  1. inverse complement, negative strand, negative direction, looking for NTTCN, 89, TTTCT at 4505, ATTCT at 4409, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, GTTCG at 4184, GTTCT at 4179, ATTCC at 4165, TTTCT at 4083, GTTCT at 4028, GTTCT at 4020, CTTCA at 3937, TTTCT at 3924, CTTCT at 3910, ATTCT at 3893, GTTCG at 3845, GTTCT at 3759, TTTCT at 3665, GTTCT at 3635, CTTCC at 3611, ATTCC at 3474, TTTCC at 3441, CTTCA at 3408, TTTCT at 3378, GTTCT at 3374, TTTCC at 3345, GTTCT at 3340, GTTCT at 3307, GTTCT at 3274, GTTCC at 3141, ATTCG at 3032, GTTCC at 2964, ATTCC at 2954, ATTCG at 2915, TTTCT at 2892, TTTCA at 2858, TTTCT at 2836, CTTCT at 2829, TTTCT at 2824, TTTCT at 2819, CTTCT at 2812, TTTCT at 2807, TTTCT at 2802, TTTCT at 2798, CTTCA at 2731, CTTCT at 2596, CTTCC at 2558, ATTCT at 2503, TTTCG at 2478, TTTCG at 2472, GTTCC at 2245, TTTCT at 2175, TTTCT at 2053, GTTCT at 2023, GTTCC at 1818, TTTCG at 1678, CTTCC at 1656, TTTCC at 1639, TTTCT at 1628, ATTCT at 1593, CTTCC at 1556, TTTCT at 1549, GTTCG at 1497, TTTCT at 1400, ATTCT at 1365, TTTCC at 1107, TTTCG at 944, GTTCT at 875, ATTCC at 818, GTTCC at 693, GTTCT at 557, GTTCG at 455, GTTCT at 420, CTTCT at 368, CTTCA at 332, ATTCA at 320, CTTCT at 242, TTTCT at 224, ATTCT at 194, TTTCG at 185, ATTCC at 176, TTTCG at 137, CTTCT at 133, GTTCC at 115, TTTCC at 105, TTTCC at 94, CTTCA at 82, GTTCC at 71, TTTCT at 55.
  2. inverse complement, negative strand, positive direction, looking for NTTCN, 60, TTTCT at 4384, CTTCC at 4242, GTTCA at 4201, GTTCT at 4074, CTTCT at 4062, CTTCA at 3995, GTTCC at 3625, CTTCT at 3395, GTTCC at 3352, CTTCT at 3313, CTTCA at 3248, ATTCT at 3074, CTTCT at 3058, CTTCA at 3032, GTTCT at 2955, CTTCT at 2948, GTTCA at 2934, GTTCT at 2923, TTTCA at 2646, CTTCT at 2583, CTTCT at 2362, TTTCA at 2302, TTTCT at 2276, TTTCA at 2264, ATTCC at 2208, ATTCT at 2180, TTTCT at 2165, CTTCA at 2108, CTTCA at 2096, GTTCT at 1988, TTTCT at 1979, GTTCG at 1927, CTTCG at 1915, TTTCG at 1750, TTTCA at 1601, CTTCG at 1517, GTTCG at 1490, CTTCC at 1433, CTTCG at 1406, GTTCG at 1390, CTTCC at 1333, CTTCG at 1306, CTTCA at 1265, TTTCG at 1181, CTTCG at 1154, TTTCC at 1097, CTTCC at 1070, CTTCG at 1013, CTTCA at 929, CTTCA at 829, CTTCG at 761, CTTCC at 734, CTTCC at 677, CTTCG at 593, GTTCA at 509, CTTCG at 457, GTTCC at 306, TTTCT at 137, ATTCT at 117, GTTCT at 108.
  3. inverse complement, positive strand, negative direction, looking for NTTCN, 27, ATTCC at 4543, CTTCA at 4529, GTTCT at 4418, GTTCA at 4176, GTTCA at 4025, CTTCC at 3777, TTTCC at 3689, CTTCT at 3554, ATTCA at 3518, ATTCG at 3501, ATTCT at 3317, TTTCA at 2885, ATTCG at 2453, TTTCT at 1604, ATTCT at 1523, ATTCT at 1416, TTTCA at 1381, GTTCA at 1178, CTTCA at 1054, GTTCG at 720, CTTCT at 620, ATTCC at 537, GTTCT at 345, GTTCA at 254, GTTCT at 45, TTTCT at 23, ATTCT at 7.
  4. inverse complement, positive strand, positive direction, looking for NTTCN, 61, CTTCT at 4264, CTTCC at 4249, CTTCA at 4198, TTTCT at 3929, TTTCA at 3920, CTTCT at 3872, CTTCC at 3852, CTTCG at 3763, CTTCG at 3668, TTTCG at 3598, CTTCG at 3217, TTTCT at 3065, TTTCC at 2919, TTTCC at 2828, ATTCT at 2790, CTTCG at 2785, CTTCG at 2749, TTTCA at 2709, GTTCC at 2693, ATTCA at 2664, GTTCA at 2616, GTTCA at 2594, TTTCG at 2536, GTTCA at 2509, ATTCC at 2457, GTTCG at 2399, CTTCG at 2193, GTTCT at 2190, ATTCC at 2085, TTTCG at 2005, GTTCT at 1948, CTTCG at 1634, CTTCG at 1595, ATTCG at 1540, GTTCA at 1526, GTTCC at 1511, GTTCC at 1427, GTTCC at 1327, GTTCC at 1259, CTTCG at 1232, TTTCC at 1091, CTTCG at 1064, GTTCC at 1007, CTTCT at 962, GTTCC at 923, CTTCT at 862, GTTCC at 823, CTTCG at 769, GTTCA at 755, CTTCG at 728, GTTCC at 671, CTTCG at 644, GTTCC at 587, CTTCG at 560, GTTCC at 503, GTTCG at 339, CTTCT at 233, CTTCC at 210, GTTCT at 178, ATTCC at 123, CTTCT at 49.

Hsf UTRs

  1. Negative strand, negative direction: AGAAG at 4528, TGAAA at 4461, AGAAT at 4406, CGAAC at 4293, TGAAC at 4267, CGAAC at 4187, TGAAT at 4162, TGAAC at 4011, TGAAA at 3984, AGAAC at 3792, CGAAG at 3776, GGAAC at 3570, AGAAG at 3553, CGAAC at 3400, TGAAC at 3241, TGAAC at 3102, TGAAA at 3075, TGAAA at 3018, CGAAT at 2935, TGAAC at 2920.
  2. Positive strand, negative direction: GGAAT at 4553, AGAAC at 4450, AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAG at 3936, TGAAA at 3922, GGAAG at 3909, TGAAC at 3783, GGAAC at 3723, GGAAT at 3677, AGAAC at 3667, GGAAA at 3663, GGAAG at 3610, AGAAA at 3591, TGAAA at 3507, GGAAC at 3459, AGAAG at 3407, AGAAA at 3376, AGAAA at 3342, TGAAC at 3244, AGAAT at 3235, TGAAA at 3146, AGAAT at 3002, GGAAA at 2967, GGAAA at 2957, GGAAA at 2926.
  3. inverse complement, negative strand, negative direction: TTTCT at 4505, ATTCT at 4409, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, GTTCG at 4184, GTTCT at 4179, ATTCC at 4165, TTTCT at 4083, GTTCT at 4028, GTTCT at 4020, CTTCA at 3937, TTTCT at 3924, CTTCT at 3910, ATTCT at 3893, GTTCG at 3845, GTTCT at 3759, TTTCT at 3665, GTTCT at 3635, CTTCC at 3611, ATTCC at 3474, TTTCC at 3441, CTTCA at 3408, TTTCT at 3378, GTTCT at 3374, TTTCC at 3345, GTTCT at 3340, GTTCT at 3307, GTTCT at 3274, GTTCC at 3141, ATTCG at 3032, GTTCC at 2964, ATTCC at 2954, ATTCG at 2915, TTTCT at 2892, TTTCA at 2858.
  4. inverse complement, positive strand, negative direction: ATTCC at 4543, CTTCA at 4529, GTTCT at 4418, GTTCA at 4176, GTTCA at 4025, CTTCC at 3777, TTTCC at 3689, CTTCT at 3554, ATTCA at 3518, ATTCG at 3501, ATTCT at 3317, TTTCA at 2885.

Hsf negative direction core promoters

  1. Positive strand, negative direction: AGAAA at 2838, AGAAA at 2831, AGAAG at 2828, AGAAA at 2821, AGAAA at 2814, AGAAG at 2811.
  2. inverse complement, negative strand, negative direction: TTTCT at 2836, CTTCT at 2829, TTTCT at 2824, TTTCT at 2819, CTTCT at 2812.

Hsf positive direction core promoters

  1. Negative strand, positive direction: GGAAC at 4443.
  2. inverse complement, negative strand, positive direction: TTTCT at 4384.
  3. Positive strand, positive direction: AGAAC at 4388, AGAAA at 4382, GGAAC at 4299.

Hsf negative direction proximal promoters

  1. Negative strand, negative direction: CGAAC at 2713.
  2. Positive strand, negative direction: AGAAG at 2811, AGAAA at 2804, AGAAA at 2800, TGAAA at 2746, GGAAG at 2730, TGAAC at 2716, TGAAT at 2707, TGAAA at 2619.
  3. inverse complement, negative strand, negative direction: TTTCT at 2807, TTTCT at 2802, TTTCT at 2798, CTTCA at 2731, CTTCT at 2596.

Hsf positive direction proximal promoters

  1. Negative strand, positive direction: GGAAG at 4263, GGAAG at 4248, AGAAG at 4197, TGAAA at 4091, AGAAC at 4067.
  2. inverse complement, negative strand, positive direction: CTTCC at 4242, GTTCA at 4201, GTTCT at 4074, CTTCT at 4062.
  3. Positive strand, positive direction: GGAAG at 4241, GGAAA at 4207, AGAAC at 4130, GGAAG at 4061.
  4. inverse complement, positive strand, positive direction: CTTCT at 4264, CTTCC at 4249, CTTCA at 4198.

Hsf negative direction distal promoters

  1. Negative strand, negative direction: TGAAC at 2579, TGAAA at 2552, CGAAC at 2378, TGAAA at 2216, TGAAC at 2126, TGAAA at 2099, CGAAC at 1972, TGAAC at 1926, TGAAA at 1790, AGAAA at 1733, TGAAA at 1687, AGAAC at 1648, TGAAC at 1618, AGAAC at 1606, TGAAT at 1545, AGAAA at 1418, TGAAC at 1299, TGAAA at 1145, TGAAG at 1053, CGAAC at 1008, CGAAC at 842, TGAAA at 681, GGAAG at 619, TGAAA at 545, TGAAA at 408, AGAAA at 347, TGAAC at 327, GGAAT at 317, AGAAC at 280, AGAAA at 47, AGAAA at 25.
  2. Positive strand, negative direction: TGAAG at 2595, GGAAG at 2557, AGAAA at 2505, GGAAA at 2458, TGAAC at 2381, AGAAT at 2372, TGAAA at 2282, CGAAA at 2157, AGAAA at 2055, TGAAC at 1955, AGAAT at 1946, TGAAA at 1855, GGAAT at 1693, GGAAC at 1684, GGAAA at 1676, GGAAA at 1660, AGAAG at 1655, GGAAA at 1642, AGAAA at 1630, TGAAA at 1625, TGAAA at 1582, CGAAG at 1555, AGAAC at 1551, AGAAT at 1520, AGAAT at 1413, TGAAC at 1302, AGAAT at 1293, TGAAA at 1212, TGAAC at 1011, AGAAT at 1002, TGAAC at 845, AGAAT at 836, CGAAA at 494, TGAAA at 473, TGAAG at 367, AGAAA at 357, GGAAG at 331, CGAAA at 312, AGAAA at 303, AGAAT at 291, AGAAC at 286, GGAAG at 241, AGAAA at 226, AGAAT at 196, AGAAA at 135, TGAAG at 132, TGAAA at 126, AGAAA at 102, GGAAG at 81, AGAAA at 52, TGAAT at 19.
  3. inverse complement, negative strand, negative direction: CTTCT at 2596, CTTCC at 2558, ATTCT at 2503, TTTCG at 2478, TTTCG at 2472, GTTCC at 2245, TTTCT at 2175, TTTCT at 2053, GTTCT at 2023, GTTCC at 1818, TTTCG at 1678, CTTCC at 1656, TTTCC at 1639, TTTCT at 1628, ATTCT at 1593, CTTCC at 1556, TTTCT at 1549, GTTCG at 1497, TTTCT at 1400, ATTCT at 1365, TTTCC at 1107, TTTCG at 944, GTTCT at 875, ATTCC at 818, GTTCC at 693, GTTCT at 557, GTTCG at 455, GTTCT at 420, CTTCT at 368, CTTCA at 332, ATTCA at 320, CTTCT at 242, TTTCT at 224, ATTCT at 194, TTTCG at 185, ATTCC at 176, TTTCG at 137, CTTCT at 133, GTTCC at 115, TTTCC at 105, TTTCC at 94, CTTCA at 82, GTTCC at 71, TTTCT at 55.
  4. inverse complement, positive strand, negative direction: ATTCG at 2453, TTTCT at 1604, ATTCT at 1523, ATTCT at 1416, TTTCA at 1381, GTTCA at 1178, CTTCA at 1054, GTTCG at 720, CTTCT at 620, ATTCC at 537, GTTCT at 345, GTTCA at 254, GTTCT at 45, TTTCT at 23, ATTCT at 7.

Hsf positive direction distal promoters

  1. Negative strand, positive direction: AGAAC at 4047, CTTCA at 3995, TGAAC at 3936, TGAAA at 3926, AGAAA at 3918, GGAAG at 3871, GGAAC at 3855, AGAAG at 3851, TGAAC at 3837, AGAAT at 3833, GGAAA at 3794, TGAAT at 3780, GGAAG at 3762, GGAAG at 3667, GTTCC at 3625, TGAAA at 3596, GGAAT at 3565, TGAAT at 3443, GGAAT at 3439, CTTCT at 3395, GGAAT at 3365, GTTCC at 3352, CTTCT at 3313, CTTCA at 3248, AGAAG at 3216, GGAAA at 3165, AGAAC at 3093, ATTCT at 3074, AGAAT at 3067, CTTCT at 3058, CTTCA at 3032, GTTCT at 2955, CTTCT at 2948, GTTCA at 2934, GTTCT at 2923, TGAAA at 2917, AGAAT at 2839, GGAAA at 2831, GGAAG at 2784, AGAAC at 2775, GGAAG at 2748, AGAAT at 2723, TTTCA at 2646, AGAAA at 2629, GGAAA at 2623, CTTCT at 2583, GGAAC at 2578, CTTCT at 2362, TTTCA at 2302, TTTCT at 2276, TTTCA at 2264, AGAAT at 2241, AGAAC at 2224, ATTCC at 2208, AGAAG at 2192, ATTCT at 2180, TTTCT at 2165, TGAAA at 2146, CTTCA at 2108, CTTCA at 2096, GTTCT at 1988, TTTCT at 1979, AGAAC at 1950, GTTCG at 1927, CTTCG at 1915, AGAAC at 1810, TTTCG at 1750, AGAAG at 1633, TTTCA at 1601, GGAAG at 1594, CTTCG at 1517, GTTCG at 1490, CTTCC at 1433, AGAAT at 1418, CTTCG at 1406, GTTCG at 1390, CTTCC at 1333, AGAAT at 1318, CTTCG at 1306, CTTCA at 1265, AGAAG at 1231, TTTCG at 1181, CTTCG at 1154, TTTCC at 1097, GGAAA at 1089, CTTCC at 1070, AGAAG at 1063, CTTCG at 1013, TGAAG at 961, CTTCA at 929, TGAAG at 861, CTTCA at 829, CGAAG at 768, CTTCG at 761, CTTCC at 734, TGAAG at 727, AGAAG at 643, CTTCC at 677, CTTCG at 593, AGAAG at 559, GTTCA at 509, CTTCG at 457, CGAAC at 362, GTTCC at 306, GGAAA at 290, TGAAG at 232, GGAAG at 209, TTTCT at 137, ATTCT at 117, GTTCT at 108, AGAAG at 48.
  2. Positive strand, positive direction: TGAAC at 4015, CGAAG at 3994, GGAAA at 3945, TTTCT at 3929, TTTCA at 3920, CTTCT at 3872, CTTCC at 3852, CTTCG at 3763, CTTCG at 3668, TTTCG at 3598, AGAAA at 3397, AGAAG at 3394, GGAAC at 3373, GGAAG at 3312, AGAAG at 3247, CTTCG at 3217, TTTCT at 3065, AGAAG at 3057, TGAAG at 3031, GGAAC at 3001, TGAAG at 2947, TTTCC at 2919, TTTCC at 2828, ATTCT at 2790, CTTCG at 2785, GGAAT at 2763, TGAAC at 2741, CTTCG at 2749, TTTCA at 2709, GTTCC at 2693, ATTCA at 2664, GTTCA at 2616, GTTCA at 2594, AGAAA at 2585, GGAAG at 2582, TTTCG at 2536, GTTCA at 2509, ATTCC at 2457, TGAAC at 2418, GTTCG at 2399, AGAAT at 2364, TGAAG at 2361, AGAAA at 2278, TGAAA at 2273, CGAAA at 2163, TGAAG at 2107, CGAAG at 2095, AGAAA at 1981, TGAAG at 1914, AGAAT at 1886, GGAAA at 1830, GGAAC at 1798, TGAAA at 1746, GGAAA at 1599, CGAAC at 1578, AGAAT at 1537, GGAAG at 1516, GGAAG at 1432, GGAAG at 1405, GGAAG at 1332, GGAAG at 1305, GGAAG at 1264, CGAAA at 1179, GGAAG at 1153, CGAAA at 1095, GGAAG at 1069, GGAAG at 1012, GGAAG at 928, GGAAG at 828, GGAAG at 760, GGAAG at 733, GGAAG at 676, CGAAC at 654, GGAAG at 592, TGAAC at 526, AGAAT at 522, GGAAG at 456, GGAAA at 134, TGAAC at 129, AGAAA at 110.
  3. inverse complement, positive strand, positive direction: CTTCG at 2193, GTTCT at 2190, ATTCC at 2085, TTTCG at 2005, GTTCT at 1948, CTTCG at 1634, CTTCG at 1595, ATTCG at 1540, GTTCA at 1526, GTTCC at 1511, GTTCC at 1427, GTTCC at 1327, GTTCC at 1259, CTTCG at 1232, TTTCC at 1091, CTTCG at 1064, GTTCC at 1007, CTTCT at 962, GTTCC at 923, CTTCT at 862, GTTCC at 823, CTTCG at 769, GTTCA at 755, CTTCG at 728, GTTCC at 671, CTTCG at 644, GTTCC at 587, CTTCG at 560, GTTCC at 503, GTTCG at 339, CTTCT at 233, CTTCC at 210, GTTCT at 178, ATTCC at 123, CTTCT at 49.

Hsf (Tang) random dataset samplings

  1. HsfTr0: 86, AGAAC at 4547, TGAAC at 4520, GGAAA at 4509, TGAAG at 4360, AGAAC at 4307, CGAAA at 4295, GGAAA at 4193, TGAAG at 4183, CGAAA at 4138, GGAAA at 4125, TGAAA at 4021, CGAAG at 3936, GGAAA at 3913, CGAAT at 3719, AGAAA at 3656, AGAAC at 3586, GGAAC at 3499, AGAAC at 3493, TGAAA at 3416, CGAAG at 3381, AGAAA at 3365, AGAAA at 3344, AGAAC at 3321, GGAAA at 3275, TGAAC at 3229, GGAAC at 3206, AGAAT at 3149, GGAAT at 3122, GGAAT at 2947, GGAAG at 2941, CGAAG at 2867, GGAAC at 2752, AGAAT at 2676, GGAAC at 2634, GGAAG at 2525, GGAAC at 2500, AGAAA at 2199, GGAAA at 2155, GGAAT at 2014, TGAAA at 2007, AGAAT at 1960, CGAAC at 1953, TGAAA at 1931, GGAAT at 1896, CGAAG at 1843, TGAAC at 1691, TGAAG at 1629, GGAAC at 1532, CGAAA at 1527, GGAAT at 1488, AGAAG at 1478, GGAAA at 1447, TGAAC at 1330, GGAAC at 1301, CGAAC at 1259, AGAAT at 1190, GGAAG at 1149, CGAAG at 1112, GGAAT at 1101, CGAAG at 962, AGAAT at 933, TGAAA at 901, CGAAC at 896, GGAAA at 830, CGAAT at 810, GGAAA at 768, AGAAA at 748, TGAAG at 745, CGAAC at 670, AGAAA at 633, AGAAA at 543, TGAAT at 464, GGAAA at 455, CGAAG at 449, CGAAT at 374, AGAAG at 297, CGAAA at 251, AGAAA at 215, TGAAG at 179, TGAAG at 162, GGAAA at 113, TGAAG at 106, CGAAC at 88, TGAAT at 78, AGAAC at 54, CGAAC at 22.
  2. HsfTr1: 83, CGAAA at 4438, CGAAT at 4427, CGAAG at 4392, GGAAG at 4363, AGAAA at 4353, TGAAT at 4339, AGAAC at 4239, CGAAT at 4217, TGAAC at 4191, TGAAA at 4007, GGAAA at 3969, CGAAC at 3877, AGAAA at 3872, TGAAA at 3794, CGAAT at 3779, GGAAC at 3726, AGAAT at 3695, GGAAG at 3669, CGAAT at 3567, GGAAG at 3562, GGAAA at 3533, AGAAA at 3268, CGAAT at 3227, GGAAA at 3216, CGAAC at 3187, GGAAC at 3182, TGAAT at 3087, AGAAT at 3080, TGAAA at 3070, GGAAT at 2987, CGAAT at 2976, TGAAC at 2907, CGAAT at 2896, TGAAG at 2831, AGAAA at 2797, TGAAG at 2730, TGAAA at 2713, GGAAC at 2659, CGAAC at 2641, AGAAC at 2606, CGAAA at 2588, TGAAG at 2556, GGAAG at 2466, CGAAA at 2456, AGAAA at 2422, CGAAG at 2382, TGAAC at 2328, GGAAC at 2317, TGAAC at 2272, AGAAT at 2268, TGAAA at 2243, GGAAC at 2036, TGAAA at 1940, TGAAA at 1867, TGAAG at 1860, CGAAG at 1808, GGAAA at 1706, GGAAT at 1539, AGAAG at 1535, TGAAC at 1505, CGAAG at 1431, GGAAA at 1421, CGAAA at 1407, TGAAG at 1039, AGAAC at 1034, GGAAC at 939, GGAAG at 928, AGAAG at 888, GGAAG at 690, CGAAC at 610, CGAAG at 543, AGAAG at 502, TGAAG at 499, AGAAC at 470, GGAAG at 467, GGAAG at 462, TGAAG at 458, TGAAT at 454, TGAAC at 391, GGAAA at 383, GGAAC at 175, AGAAG at 159, GGAAC at 94.
  3. RDr2: 0.
  4. RDr3: 0.
  5. RDr4: 0.
  6. RDr5: 0.
  7. RDr6: 0.
  8. RDr7: 0.
  9. RDr8: 0.
  10. RDr9: 0.
  11. RDr0ci: 0.
  12. RDr1ci: 0.
  13. RDr2ci: 0.
  14. RDr3ci: 0.
  15. RDr4ci: 0.
  16. RDr5ci: 0.
  17. RDr6ci: 0.
  18. RDr7ci: 0.
  19. RDr8ci: 0.
  20. RDr9ci: 0.

HsfTr arbitrary UTRs

  1. HsfTr0: AGAAC at 4547, TGAAC at 4520, GGAAA at 4509, TGAAG at 4360, AGAAC at 4307, CGAAA at 4295, GGAAA at 4193, TGAAG at 4183, CGAAA at 4138, GGAAA at 4125, TGAAA at 4021, CGAAG at 3936, GGAAA at 3913, CGAAT at 3719, AGAAA at 3656, AGAAC at 3586, GGAAC at 3499, AGAAC at 3493, TGAAA at 3416, CGAAG at 3381, AGAAA at 3365, AGAAA at 3344, AGAAC at 3321, GGAAA at 3275, TGAAC at 3229, GGAAC at 3206, AGAAT at 3149, GGAAT at 3122, GGAAT at 2947, GGAAG at 2941, CGAAG at 2867.

HsfTr alternate UTRs

  1. HsfTr1: CGAAA at 4438, CGAAT at 4427, CGAAG at 4392, GGAAG at 4363, AGAAA at 4353, TGAAT at 4339, AGAAC at 4239, CGAAT at 4217, TGAAC at 4191, TGAAA at 4007, GGAAA at 3969, CGAAC at 3877, AGAAA at 3872, TGAAA at 3794, CGAAT at 3779, GGAAC at 3726, AGAAT at 3695, GGAAG at 3669, CGAAT at 3567, GGAAG at 3562, GGAAA at 3533, AGAAA at 3268, CGAAT at 3227, GGAAA at 3216, CGAAC at 3187, GGAAC at 3182, TGAAT at 3087, AGAAT at 3080, TGAAA at 3070, GGAAT at 2987, CGAAT at 2976, TGAAC at 2907, CGAAT at 2896.

RDr arbitrary negative direction core promoters

RDr alternate negative direction core promoters

  1. HsfTr1: TGAAG at 2831.

HsfTr arbitrary positive direction core promoters

  1. HsfTr1: CGAAA at 4438, CGAAT at 4427, CGAAG at 4392, GGAAG at 4363, AGAAA at 4353, TGAAT at 4339.

HsfTr alternate positive direction core promoters

  1. HsfTr0: AGAAC at 4547, TGAAC at 4520, GGAAA at 4509, TGAAG at 4360, AGAAC at 4307, CGAAA at 4295.

HsfTr arbitrary negative direction proximal promoters

  1. HsfTr0: GGAAC at 2752, AGAAT at 2676, GGAAC at 2634.

HsfTr alternate negative direction proximal promoters

  1. HsfTr1: AGAAA at 2797, TGAAG at 2730, TGAAA at 2713, GGAAC at 2659, CGAAC at 2641, AGAAC at 2606.

HsfTr arbitrary positive direction proximal promoters

  1. HsfTr1: AGAAC at 4239, CGAAT at 4217, TGAAC at 4191.

HsfTr alternate positive direction proximal promoters

  1. HsfTr0: GGAAA at 4193, TGAAG at 4183, CGAAA at 4138, GGAAA at 4125.

HsfTr arbitrary negative direction distal promoters

  1. HsfTr0: GGAAG at 2525, GGAAC at 2500, AGAAA at 2199, GGAAA at 2155, GGAAT at 2014, TGAAA at 2007, AGAAT at 1960, CGAAC at 1953, TGAAA at 1931, GGAAT at 1896, CGAAG at 1843, TGAAC at 1691, TGAAG at 1629, GGAAC at 1532, CGAAA at 1527, GGAAT at 1488, AGAAG at 1478, GGAAA at 1447, TGAAC at 1330, GGAAC at 1301, CGAAC at 1259, AGAAT at 1190, GGAAG at 1149, CGAAG at 1112, GGAAT at 1101, CGAAG at 962, AGAAT at 933, TGAAA at 901, CGAAC at 896, GGAAA at 830, CGAAT at 810, GGAAA at 768, AGAAA at 748, TGAAG at 745, CGAAC at 670, AGAAA at 633, AGAAA at 543, TGAAT at 464, GGAAA at 455, CGAAG at 449, CGAAT at 374, AGAAG at 297, CGAAA at 251, AGAAA at 215, TGAAG at 179, TGAAG at 162, GGAAA at 113, TGAAG at 106, CGAAC at 88, TGAAT at 78, AGAAC at 54, CGAAC at 22.

HsfTr alternate negative direction distal promoters

  1. HsfTr1: CGAAA at 2588, TGAAG at 2556, GGAAG at 2466, CGAAA at 2456, AGAAA at 2422, CGAAG at 2382, TGAAC at 2328, GGAAC at 2317, TGAAC at 2272, AGAAT at 2268, TGAAA at 2243, GGAAC at 2036, TGAAA at 1940, TGAAA at 1867, TGAAG at 1860, CGAAG at 1808, GGAAA at 1706, GGAAT at 1539, AGAAG at 1535, TGAAC at 1505, CGAAG at 1431, GGAAA at 1421, CGAAA at 1407, TGAAG at 1039, AGAAC at 1034, GGAAC at 939, GGAAG at 928, AGAAG at 888, GGAAG at 690, CGAAC at 610, CGAAG at 543, AGAAG at 502, TGAAG at 499, AGAAC at 470, GGAAG at 467, GGAAG at 462, TGAAG at 458, TGAAT at 454, TGAAC at 391, GGAAA at 383, GGAAC at 175, AGAAG at 159, GGAAC at 94.

HsfTr arbitrary positive direction distal promoters

  1. HsfTr1: TGAAA at 4007, GGAAA at 3969, CGAAC at 3877, AGAAA at 3872, TGAAA at 3794, CGAAT at 3779, GGAAC at 3726, AGAAT at 3695, GGAAG at 3669, CGAAT at 3567, GGAAG at 3562, GGAAA at 3533, AGAAA at 3268, CGAAT at 3227, GGAAA at 3216, CGAAC at 3187, GGAAC at 3182, TGAAT at 3087, AGAAT at 3080, TGAAA at 3070, GGAAT at 2987, CGAAT at 2976, TGAAC at 2907, CGAAT at 2896, TGAAG at 2831, AGAAA at 2797, TGAAG at 2730, TGAAA at 2713, GGAAC at 2659, CGAAC at 2641, AGAAC at 2606, CGAAA at 2588, TGAAG at 2556, GGAAG at 2466, CGAAA at 2456, AGAAA at 2422, CGAAG at 2382, TGAAC at 2328, GGAAC at 2317, TGAAC at 2272, AGAAT at 2268, TGAAA at 2243, GGAAC at 2036, TGAAA at 1940, TGAAA at 1867, TGAAG at 1860, CGAAG at 1808, GGAAA at 1706, GGAAT at 1539, AGAAG at 1535, TGAAC at 1505, CGAAG at 1431, GGAAA at 1421, CGAAA at 1407, TGAAG at 1039, AGAAC at 1034, GGAAC at 939, GGAAG at 928, AGAAG at 888, GGAAG at 690, CGAAC at 610, CGAAG at 543, AGAAG at 502, TGAAG at 499, AGAAC at 470, GGAAG at 467, GGAAG at 462, TGAAG at 458, TGAAT at 454, TGAAC at 391, GGAAA at 383, GGAAC at 175, AGAAG at 159, GGAAC at 94.

HsfTr alternate positive direction distal promoters

  1. HsfTr0: TGAAA at 4021, CGAAG at 3936, GGAAA at 3913, CGAAT at 3719, AGAAA at 3656, AGAAC at 3586, GGAAC at 3499, AGAAC at 3493, TGAAA at 3416, CGAAG at 3381, AGAAA at 3365, AGAAA at 3344, AGAAC at 3321, GGAAA at 3275, TGAAC at 3229, GGAAC at 3206, AGAAT at 3149, GGAAT at 3122, GGAAT at 2947, GGAAG at 2941, CGAAG at 2867, GGAAC at 2752, AGAAT at 2676, GGAAC at 2634, GGAAG at 2525, GGAAC at 2500, AGAAA at 2199, GGAAA at 2155, GGAAT at 2014, TGAAA at 2007, AGAAT at 1960, CGAAC at 1953, TGAAA at 1931, GGAAT at 1896, CGAAG at 1843, TGAAC at 1691, TGAAG at 1629, GGAAC at 1532, CGAAA at 1527, GGAAT at 1488, AGAAG at 1478, GGAAA at 1447, TGAAC at 1330, GGAAC at 1301, CGAAC at 1259, AGAAT at 1190, GGAAG at 1149, CGAAG at 1112, GGAAT at 1101, CGAAG at 962, AGAAT at 933, TGAAA at 901, CGAAC at 896, GGAAA at 830, CGAAT at 810, GGAAA at 768, AGAAA at 748, TGAAG at 745, CGAAC at 670, AGAAA at 633, AGAAA at 543, TGAAT at 464, GGAAA at 455, CGAAG at 449, CGAAT at 374, AGAAG at 297, CGAAA at 251, AGAAA at 215, TGAAG at 179, TGAAG at 162, GGAAA at 113, TGAAG at 106, CGAAC at 88, TGAAT at 78, AGAAC at 54, CGAAC at 22.

HSE1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAnnTTCnnGAAn (starting with SuccessablesHSE1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.

HSE2 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCnnGAAnnTTCn (starting with SuccessablesHSE2.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found: HSE2 is the inverse complement of HSE1.

HSE3 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGAAnnTTCn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.

HSE3 distal promoters

Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332, and complement.

HSE4 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn (starting with SuccessablesHSE4.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 1, AGAAGAAAAAAGAAAAGAGAAGAAA at 2831.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 1, TCTTCTTTTTTCTTTTCTCTTCTTT at 2831.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.

HSE4 distal promoters

Positive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831, and complement.

HSE5 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-(5-bp)-nTTCnnGAAn (starting with SuccessablesHSE5.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nTTCn-(5-bp)-nTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nTTCn-(5-bp)-nTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nTTCn-(5-bp)-nTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAn-(5-bp)-nGAAn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAn-(5-bp)-nGAAn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAn-(5-bp)-nGAAn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAn-(5-bp)-nGAAn, 0.
  13. inverse negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  14. inverse negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  15. inverse positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.
  16. inverse positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGnnCTTn, 0.

HSE6 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-nnGAAn-(5-bp)-nGAAn (starting with SuccessablesHSE6.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nTTCn-nnGAAn-(5-bp)-nGAAn, 0.
  2. negative strand, positive direction, looking for nTTCn-nnGAAn-(5-bp)-nGAAn, 0.
  3. positive strand, negative direction, looking for nTTCn-nnGAAn-(5-bp)-nGAAn, 0.
  4. positive strand, positive direction, looking for nTTCn-nnGAAn-(5-bp)-nGAAn, 0.
  5. complement, negative strand, negative direction, looking for nAAGn-nnCTTn-(5-bp)-nCTTn, 0.
  6. complement, negative strand, positive direction, looking for nAAGn-nnCTTn-(5-bp)-nCTTn, 0.
  7. complement, positive strand, negative direction, looking for nAAGn-nnCTTn-(5-bp)-nCTTn, 0.
  8. complement, positive strand, positive direction, looking for nAAGn-nnCTTn-(5-bp)-nCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCnn-nGAAn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCn-(5-bp)-nTTCnn-nGAAn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCn-(5-bp)-nTTCnn-nGAAn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCn-(5-bp)-nTTCnn-nGAAn, 0.
  13. inverse negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGnn-nCTTn, 0.
  14. inverse negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGnn-nCTTn, 0.
  15. inverse positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGnn-nCTTn, 0.
  16. inverse positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGnn-nCTTn, 0.

HSE7 PFT1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGA(A/G)nnTTCnnGAAn (starting with Successables PFT1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGA(A/G)nnTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nGA(A/G)nnTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nGA(A/G)nnTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nGA(A/G)nnTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCT(C/T)nnAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nCT(C/T)nnAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCT(C/T)nnAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCT(C/T)nnAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAnn(C/T)TCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAnn(C/T)TCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAnn(C/T)TCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAnn(C/T)TCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGnnCTTnn(A/G)AGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGnnCTTnn(A/G)AGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGnnCTTnn(A/G)AGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGnnCTTnn(A/G)AGn, 0.

HSE7 PFT2 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAnnTTCnnGARn (starting with SuccessablesHSE1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAnnTTCnnGA(A/G)n, 0.
  2. negative strand, positive direction, looking for nGAAnnTTCnnGA(A/G)n, 0.
  3. positive strand, negative direction, looking for nGAAnnTTCnnGA(A/G)n, 0.
  4. positive strand, positive direction, looking for nGAAnnTTCnnGA(A/G)n, 0.
  5. complement, negative strand, negative direction, looking for nCTTnnAAGnnCT(C/T)n, 0.
  6. complement, negative strand, positive direction, looking for nCTTnnAAGnnCT(C/T)n, 0.
  7. complement, positive strand, negative direction, looking for nCTTnnAAGnnCT(C/T)n, 0.
  8. complement, positive strand, positive direction, looking for nCTTnnAAGnnCT(C/T)n, 0.
  9. inverse complement, negative strand, negative direction, looking for n(C/T)TCnnGAAnnTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for n(C/T)TCnnGAAnnTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for n(C/T)TCnnGAAnnTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for n(C/T)TCnnGAAnnTTCn, 0.
  13. inverse negative strand, negative direction, looking for n(A/G)AGnnCTTnnAAGn, 0.
  14. inverse negative strand, positive direction, looking for n(A/G)AGnnCTTnnAAGn, 0.
  15. inverse positive strand, negative direction, looking for n(A/G)AGnnCTTnnAAGn, 0.
  16. inverse positive strand, positive direction, looking for n(A/G)AGnnCTTnnAAGn, 0.

HSE8 GAP1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGA(A/G)n-(5-bp)-nGAAnnTTCn (starting with SuccessablesGAP1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGA(A/G)n-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGA(A/G)n-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGA(A/G)n-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGA(A/G)n-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCT(C/T)n-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCT(C/T)n-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCT(C/T)n-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCT(C/T)n-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-n(C/T)TCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-n(C/T)TCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-n(C/T)TCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-n(C/T)TCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-n(A/G)AGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-n(A/G)AGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-n(A/G)AGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-n(A/G)AGn, 0.

HSE9 GAP2 (Eastmond) distal promoters

Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332, and complement.

HSE9 GAP2 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGARnnTTCn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGA(A/G)nnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGA(A/G)nnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGA(A/G)nnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGA(A/G)nnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCT(C/T)nnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCT(C/T)nnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCT(C/T)nnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCT(C/T)nnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnn(C/T)TCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnn(C/T)TCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnn(C/T)TCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnn(C/T)TCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnn(A/G)AGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnn(A/G)AGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnn(A/G)AGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnn(A/G)AGn-(5-bp)-nAAGn, 0.

HSE9 GAP2 (Eastmond) distal promoters

Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332, and complement.

HSE10 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn, 0.
  2. negative strand, positive direction, looking for nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn, 0.
  3. positive strand, negative direction, looking for nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn, 0.
  4. positive strand, positive direction, looking for nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn, 0.
  5. complement, negative strand, negative direction, looking for nAAGn-(11-bp)-nCTTn-(5-bp)-nCTTn, 0.
  6. complement, negative strand, positive direction, looking for nAAGn-(11-bp)-nCTTn-(5-bp)-nCTTn, 0.
  7. complement, positive strand, negative direction, looking for nAAGn-(11-bp)-nCTTn-(5-bp)-nCTTn, 0.
  8. complement, positive strand, positive direction, looking for nAAGn-(11-bp)-nCTTn-(5-bp)-nCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(11-bp)-nGAAn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(11-bp)-nGAAn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(11-bp)-nGAAn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(11-bp)-nGAAn, 0.
  13. inverse negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(11-bp)-nCTTn, 0.
  14. inverse negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(11-bp)-nCTTn, 0.
  15. inverse positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(11-bp)-nCTTn, 0.
  16. inverse positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(11-bp)-nCTTn, 0.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Dawn L. Eastmond and Hillary C. M. Nelson (October 27, 2006). "Genome-wide Analysis Reveals New Roles for the Activation Domains of the Saccharomyces cerevisiae Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response". Journal of Biological Chemistry. 281 (43): P32909–32921. doi:10.1074/jbc.M602454200. Retrieved 19 January 2021.
  2. Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

External links