Serum response element gene transcriptions

Associate Editor(s)-in-Chief: Henry A. Hoff

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.^[1]

Consensus sequences

In the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC,

5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG,

5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG,

5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F",

5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.

SER samplings

Copying a responsive elements consensus sequence ACAGGATGT and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACAGGATGT (starting with SuccessablesSER.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

negative strand, negative direction, looking for AAAAAAAA, 0.
positive strand, negative direction, looking for AAAAAAAA, 0.
positive strand, positive direction, looking for AAAAAAAA, 0.
negative strand, positive direction, looking for AAAAAAAA, 0.
complement, negative strand, negative direction, looking for TTTTTTTT, 0.
complement, positive strand, negative direction, looking for TTTTTTTT, 0.
complement, positive strand, positive direction, looking for TTTTTTTT, 0.
complement, negative strand, positive direction, looking for TTTTTTTT, 0.
inverse complement, negative strand, negative direction, looking for TTTTTTTT, 0.
inverse complement, positive strand, negative direction, looking for TTTTTTTT, 0.
inverse complement, positive strand, positive direction, looking for TTTTTTTT, 0.
inverse complement, negative strand, positive direction, looking for TTTTTTTT, 0.
inverse negative strand, negative direction, looking for AAAAAAAA, 0.
inverse positive strand, negative direction, looking for AAAAAAAA, 0.
inverse positive strand, positive direction, looking for AAAAAAAA, 0.
inverse negative strand, positive direction, looking for AAAAAAAA, 0.

SER UTRs

SER core promoters

SER proximal promoters

SER distal promoters

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

References

↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.

External links

v t e Gene project
Articles	Complex locus A1BG and ZNF497 Grainyhead-like Genes in Regulating Development and Genetic Defects Lysenin Lysine: biosynthesis, catabolism and roles RIG-I like receptors ShK toxin: history, structure and therapeutic applications for autoimmune diseases
Categories	Biochemistry Biology Genetics Medicine
Laboratories	AGC box gene transcription laboratory ATA box gene transcription laboratory C and D boxes gene transcription laboratory CArG box gene transcription laboratory CGCG box gene transcription laboratory CRE box gene transcription laboratory E2 box gene transcription laboratory Enhancer box gene transcription laboratory Factor II B recognition element gene transcription laboratory GA responsive complex gene transcription laboratory GC box gene transcription laboratory H box gene transcription laboratory HNF6 gene transcription laboratory HY box gene transcription laboratory Initiator element gene transcription laboratory Metal responsive element gene transcription laboratory STAT5 gene transcription laboratory TATA box gene transcription laboratory
Lessons	A1BG gene transcription programming Amino Acids Enzymes Enzyme catalysis Enzyme structure and function Eukaryotic transcription Gene regulation in prokaryotes
Lists	Biomolecules
Modules	Module:Infobox gene Module:InfoboxImage
Original research	Gene project
Projects	Biochemistry Gene project History of biology Molecular Biology Molecular evolution Topobiology
Proposals	Gene expressions/Cost sharing and research products Gene expressions in human exploration beyond low earth orbits Gene expressions/Project narrative
Resources	5' cap Acid-base homeostasis Actins Adenines Allergies Alpha-1-B glycoprotein Ammonoids Original research/Amino acids Amphiphiles Anabolism Animal physiology Anomeric carbons Autocatalytic reactions Autonomously replicating sequences Base pairs Biology Biodegradation Biosynthesis Biosynthesis of a human protein Biosynthesis of amino acids Blood Bodily fluids Botany Brain box Calcium signaling Capping enzymes Carbohydrates Carcinoembryonic antigen gene family Catabolism Catalysis Cells Cell signaling Centrosomes Chromatins Chromoboxes Coactivators Corepressors Cofactors Consensus sequences Cytogenetics Cytokinesis Cytosines Deoxyribonucleic acids Digestion Disaccharides Dispersed promoters Dominant group metagenomes Downregulations Endochondral ossification Enzyme inhibitors Enzymology Epigenetics Epigenomes Esters Esterification Eukaryotes Eukaryotic initiation factors Evolution Exaptation Excision repair cross-complementing Factors Fatty acids Ferredoxin Foldings Foods Forkhead boxes Functional groups Genome surveillance complexes Genealogy Genes Genetics Gene transcriptions Genomes Genomics Glycoproteins Glycosides Glycosidic bond Guanines Hair color gene expressions Helicases Heredity History of agriculture Greek and Roman histories of biology Homeostasis Human amino acid synthesis Human DNAs Human genes Human RNA Human teeth Human temperatures Immunoglobulin domain cl11960 Immunoglobulin domain genes Immunoglobulin like domain cd05751 Immunoglobulin like domain pfam13895 Immunoglobulin like domain smart00410 Immunoglobulin receptor superfamily genes Immunoglobulin supergene family Inhibitory peptides Insulators Intranuclear localizations Introduction to Cell Biology Introduction to polymer chemistry Lamarckism Leucine zipper Localization Major histocompatibility complex class I gene family Major histocompatibility complex class II gene family Major histocompatibility complex class III gene family Mammalogy Mathematical molecular biology Mediator complexes Medicine Melanocytes Membranes Metagenomes Molecular biology Molecular genetics Nitrogen metabolism Nucleotide Synthesis Origin of life Orthomolecular medicine Osteoarthritis Paleanthropology Paleontology Phosphate biochemistry Phosphate budgets Phosphate reactions Post translational modifications Principles of biosynthesis Protein isoform Proteins Proteomics Regulations Ribonucleotides Ribosomes RNA polymerases RNA polymerase II holoenzymes RNA polymerase II holoenzyme complexes RNA translations Salinity Stroke management Teeth TFIIA Transports Vascular endothelial growth factor A What is a human? Upregulations Upstream and downstream ZSCAN22 Zoology
Transcription resources	A1BG gene transcription core promoters A1BG gene transcriptions A1BG regulatory elements and regions A1BG response element gene transcriptions A1BG response element negative results A1BG response element positive results ABA-response element gene transcriptions Abf1 regulatory factor gene transcriptions A box gene transcriptions ACGT-containing element gene transcriptions Activating protein gene transcriptions Activating transcription factor gene transcriptions Adenylate–uridylate rich element gene transcriptions Adr1p gene transcriptions Aft1p gene transcriptions AGC box gene transcriptions AGCE gene transcriptions Alpha-amylase conserved element gene transcriptions Amino acid response element gene transcriptions AARE-like Androgen response element gene transcriptions Angiotensinogen core promoter element gene transcriptions Antioxidant-electrophile responsive element gene transcriptions ATA box gene transcriptions Auxin response factor gene transcriptions B box gene transcriptions Bioinformatics tool gene transcriptions Box gene transcriptions Bridge gene transcriptions CAAT box gene transcriptions CadC binding domain gene transcriptions Calcineurin-responsive transcription factor gene transcriptions Calcium-response element gene transcriptions cAMP response element gene transcriptions C and D boxes gene transcriptions Carbohydrate response element gene transcriptions Carbon source-responsive element gene transcriptions Carcinoembryonic antigen gene family CARE gene transcriptions CArG box gene transcriptions CAT box gene transcriptions Cat8p gene transcriptions Cbf1 regulatory factor gene transcriptions C box gene transcriptions CCCTC-binding factor gene transcriptions C-EBP box gene transcriptions Cell-cycle box gene transcriptions Cell cycle regulation gene transcriptions CENP-B box gene transcriptions CGCG box gene transcriptions Circadian control element gene transcriptions Cold-responsive element gene transcriptions Complement copy gene transcriptions Complement-inverse copy gene transcriptions Consensus sequence gene transcriptions Copper response element gene transcriptions Core promoter gene transcriptions Coupling element gene transcriptions CRE box gene transcriptions Cytokinin response regulator gene transcriptions Cytoplasmic polyadenylation element gene transcriptions DAF-16-associated element gene transcriptions DAF-16 binding element gene transcriptions D box gene transcriptions Defense and stress-responsive element gene transcriptions Degenerate nucleotide gene transcriptions Dispersed promoter gene transcriptions Distal promoter gene transcriptions DNA melting gene transcriptions DNA damage response element gene transcriptions DNA replication-related element gene transcriptions Downstream core element gene transcriptions Downstream promoter element gene transcriptions Downstream TFIIB recognition element gene transcriptions DREB box gene transcriptions E2 box gene transcriptions EIF4E basal element gene transcriptions EIN3 binding site gene transcriptions Enhancer activity copy gene transcriptions E box gene transcriptions Element gene transcriptions Endoplasmic reticulum stress response element gene transcriptions Endosperm expression gene transcriptions Enhancer box gene transcriptions Estrogen response element gene transcriptions Ethylene responsive element gene transcriptions Factor II B recognition element gene transcriptions F box gene transcriptions Focused promoter gene transcriptions Forkhead box gene transcriptions Fur box gene transcriptions GAAC element gene transcriptions Gal4p gene transcriptions Γ-interferon activated sequence gene transcriptions GARE gene transcriptions GA responsive complex gene transcriptions GATA gene transcriptions G box gene transcriptions GC box gene transcriptions GCC box gene transcriptions Gcn4p gene transcriptions Gcr1p gene transcriptions Gene expressions General factor II D gene transcriptions General regulatory factors General transcription factor II A gene transcriptions General transcription factor II B gene transcriptions General transcription factor II D gene transcriptions General transcription factor II F gene transcriptions General transcription factor II H gene transcriptions General transcription factor gene transcriptions Gene transcriptions GGC triplet gene transcriptions Gibberellin responsive element gene transcriptions GLM box gene transcriptions Glucocorticoid response element gene transcriptions Grainy head gene transcriptions Grainy head transcription factor gene transcriptions Growth hormone response element gene transcriptions GT boxes Hac1p gene transcriptions Hair color gene expressions H and ACA box gene transcriptions H box gene transcriptions Heat-responsive element gene transcriptions Hex sequence gene transcriptions HMG box gene transcriptions HNF gene transcriptions Homeobox gene transcriptions Hsf1p gene transcriptions HY box gene transcriptions Hybrid C, A boxes Hybrid C, G boxes Hybrid C, T boxes Hypoxia-inducible factor gene transcriptions Hypoxia response elements I box gene transcriptions Initiator element gene transcriptions Initiator-like element gene transcriptions Inositol/choline-responsive elements Interaction gene transcriptions Interferon regulatory factors Inverse copy gene transcriptions Jasmonic acid-responsive element gene transcriptions K-boxes Kozak sequence gene transcriptions Kruppel-associated box gene transcriptions Krüppel-like factor gene transcriptions L box gene transcriptions Leu3 gene transcriptions M35 box gene transcriptions MADS box gene transcriptions Maf recognition element gene transcriptions M box gene transcriptions Mcm1 regulatory factor gene transcriptions Met31p box gene transcriptions Metal responsive element gene transcriptions Middle sporulation element gene transcriptions Mig1p gene transcriptions Model samplings Motif ten element gene transcriptions Msn2,4p gene transcriptions Musashi binding element gene transcriptions MYB recognition element gene transcriptions Myelocytomatosis transcription factor gene transcriptions Myocyte enhancer factor gene transcriptions N-boxes Ndt80p gene transcriptions Nuclear factor 1 Nuclear factor 𝜿B Nuclear factor gene transcriptions Nuclear factor of activated T cell gene transcriptions (NFAT) Nuclear factor Y gene transcriptions Nutrient-sensing response element gene transcriptions Oaf1p gene transcriptions ORE1 binding site gene transcriptions p53 response element gene transcriptions P63 DNA-binding site gene transcriptions P box gene transcriptions Pdr1,3p gene transcriptions Peroxisome proliferator hormone response element gene transcriptions Phosphate starvation-response transcription factor gene transcriptions Pollen1 element gene transcriptions Polycomb response element gene transcriptions Preinitiation complex Preinitiation complex gene transcriptions Pribnow box gene transcriptions Prolamin box gene transcriptions Promoter gene transcriptions Proximal promoter gene transcriptions Promoter occurrence gene transcriptions Pyrimidine box gene transcriptions Q element gene transcriptions Rap1 regulatory factor gene transcriptions Reb1 general regulatory factor gene transcriptions Retinoblastoma control element gene transcriptions Retinoic acid response element gene transcriptions Rgt1p gene transcriptions Rlm1p gene transcriptions RNA polymerase II gene transcriptions RNA polymerase II holoenzyme complex Root specific element gene transcriptions ROR-response element gene transcriptions Rox1p gene transcriptions Rpn4p gene transcriptions R response element gene transcriptions SARE gene transcriptions Seed-specific element gene transcriptions Serum response element gene transcriptions Servenius sequence gene transcriptions Shoot specific element gene transcriptions Sip4p gene transcriptions Smp1p gene transcriptions Sp1 gene transcriptions Spaceflight gene expressions Specificity protein gene transcriptions STAT gene transcriptions Ste12p gene transcriptions Sterol response element gene transcriptions Sucrose box gene transcriptions Synaptic Activity-Responsive Elements TACTAAC box gene transcriptions TAGteam gene transcriptions Tapetum box gene transcriptions TATA binding protein associated factor gene transcriptions TATA binding protein gene transcriptions TATA box gene transcriptions TAT box gene transcriptions TATC box gene transcriptions Tbf1 regulatory factor gene transcriptions T box gene transcriptions TCCACCATA element gene transcriptions TC element gene transcriptions TCT gene transcriptions TEA consensus sequence gene transcriptions Tec1p gene transcriptions Telomeric repeat DNA-binding factor gene transcriptions Tetradecanoylphorbol-13-acetate response element gene transcriptions TGF-β control elements (TCEs) TGF-β inhibitory elements (TIEs) Thyroid hormone response element gene transcriptions Transcriptional regulation Transcription bubble gene transcriptions Transcription factor gene transcriptions Transcription factor 3 gene transcriptions Transcription factory gene transcriptions Transcription start site gene transcriptions Translational control sequence gene transcriptions U box gene transcriptions Unfolded protein response element gene transcriptions Upstream response element gene transcriptions Upstream stimulatory factor gene transcriptions UTR promoter gene transcriptions V and P box gene transcriptions V box gene transcriptions Vhr1p gene transcriptions Vitamin D response element gene transcriptions W box gene transcriptions X box gene transcriptions Xbp1p gene transcriptions X core promoter element gene transcriptions Xenobiotic response element gene transcriptions Xenobiotic responsive element gene transcriptions Yap1p,2p gene transcriptions Y box gene transcriptions YY1 gene transcriptions Zap1p gene transcriptions Z box gene transcriptions Zinc responsive element gene transcriptions