A1BG regulatory elements and regions

It may be still fair to say that in the apparent present era of functional genomics, the challenge is to elucidate gene function such as that of A1BG, its likely regulatory networks and signaling pathways. "Since regulation of gene expression in vivo mainly occurs at the transcriptional level, identifying the location of genetic regulatory elements is a key to understanding the machinery regulating gene transcription. A major goal of current genome research is to identify the locations of all gene regulatory elements, including promoters, enhancers, silencers, insulators and boundary elements, and to analyze their relationship to the current annotation of human genes." Although "many genome-wide strategies have been developed for identifying functional elements", "no method yet has the resolution to precisely identify all regulatory elements or can be readily applied to the entire human genome."

"The experimental evidence demonstrates that genome binding specificity is achieved through the interplay of at least three factors: DNA sequence; DNA shape; and occlusion by chromatin."

There is one CRISPRi-validated cis-regulatory element on 19q13.43: Gene ID: 116286197 LOC116286197. And, four Sharpr-MPRA regulatory regions: (1) Gene ID: 112553117 LOC112553117 Sharpr-MPRA regulatory region 1998, Gene ID: 112553119 LOC112553119 Sharpr-MPRA regulatory region 10473, Gene ID: 112577453 LOC112577453 Sharpr-MPRA regulatory region 7872, and Gene ID: 112577454 is Sharpr-MPRA regulatory region 9894.

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions" are called response elements.

Heterodimers

Some bZIP proteins, "including LIP19, OsZIP-2a, and OsZIP-2b, do not bind to DNA sequences. Instead, these bZIP proteins form heterodimers with other bZIPs to regulate transcriptional activities (Nantel and Quatrano, 1996; Shimizu et al., 2005)."

DNase I hypersensitive sites

"This genomic region represents a DNase I hypersensitive site (DHS) that was predicted to be an enhancer by the ENCODE (ENCyclopedia Of DNA Elements) project based on various combinations of H3K27 acetylation and binding of p300, GATA1 and RNA polymerase II in K562 erythroleukemia cells. It was validated as a high-confidence cis-regulatory element for the ZNF582 (zinc finger protein 582) gene on chromosome 19 based on multiplex CRISPR/Cas9-mediated perturbation in K562 cells."

Gene ID: 116286197 CRISPRi-validated cis-regulatory element chr19.6329 is at NC_000019.10 (56186901..56187499).

Gene ID: 147948 ZNF582 is at NC_000019.10 (56382751..56393585, complement). The CRISPRi-validated cis-regulatory element chr19.6329 is (56382751 - 56186901) = 195850 nts from the beginning of ZNF582.

Transcriptional regulatory regions

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 5:Enh, candidate strong enhancer, open chromatin). It also displayed weak repressive activity by Sharpr-MPRA in K562 erythroleukemia cells (group: K562 Repressive non-DNase unmatched - State 24:Quies, heterochromatin/dead zone)."

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in both HepG2 liver carcinoma cells (group: HepG2 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region) and K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss)."

"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."

"The growth hormone-regulated transcription factors STAT5 and BCL6 coordinately regulate sex differences in mouse liver, primarily through effects in male liver, where male-biased genes are upregulated and many female-biased genes are actively repressed." "CUX2, a highly female-specific liver transcription factor, contributes to an analogous regulatory network in female liver. Adenoviral overexpression of CUX2 in male liver induced 36% of female-biased genes and repressed 35% of male-biased genes. In female liver, CUX2 small interfering RNA (siRNA) preferentially induced genes repressed by adenovirus expressing CUX2 (adeno-CUX2) in male liver, and it preferentially repressed genes induced by adeno-CUX2 in male liver. CUX2 binding in female liver chromatin was enriched at sites of male-biased DNase hypersensitivity and at genomic regions showing male-enriched STAT5 binding. CUX2 binding was also enriched near genes repressed by adeno-CUX2 in male liver or induced by CUX2 siRNA in female liver but not at genes induced by adeno-CUX2, indicating that CUX2 binding is preferentially associated with gene repression. Nevertheless, direct CUX2 binding was seen at several highly female-specific genes that were positively regulated by CUX2, including A1bg [A1BG in humans], Cyp2b9, Cyp3a44, Tox [TOX in humans], and Trim24 [TRIM24 in humans]."

"Gene list comparisons were performed using the compare class utility provided by the Regulatory Sequence Analysis Tools (34). Comparisons were made with previous 3-AT and rapamycin data sets (5, 14) and with several predefined gene lists such as genes induced by promoters bound in chromatin immunoprecipitation (ChIP-chip) experiments (35), genes in the MIPS functional catalogue (36), and gene ontology categories (37) as described by Godard et al. (38). The significance of overlap between gene lists was quantitatively determined by the hypergeometric distribution (39), using the number of probe sets on the S98 array as the population size, or by calculating the representation factor (40) using the web utility Microarray Analysis Tools. Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters. The program oligo-analysis (41) was used to search the promoter regions of co-regulated genes for overrepresented sequence motifs. Analysis of the 5􏰈-noncoding regions of the GCN4-dependent activation core identified the consensus [general control responsive element] GCRE motif (TGABTVW)."

ABA-response elements

Main article: ABA-response element gene transcriptions

"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."

"Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."

Abf1 regulatory factors

Main article: Abf1 regulatory factor gene transcriptions

Specific "sequences considered as exact Abf1 motif occurrences": CGTNNNNNACGA(C/T), CGTNNNNNA(C/T)GAC, CGTNNNNNA(C/T)GA(C/T), CGTNNNNN(A/G)(C/T)GA(C/T).

A boxes

Main article: A box gene transcriptions

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box), GACGTC (C box), TACGTA (A box), AACGTT (T box), and a GCN4 motif, namely TGA(G/C)TCA (Landschulz et al., 1988; Nijhawan et al., 2008)."

"The human TGF-β1 promoter region contains two binding sequences for AP-1, designated AP-1 box A (TGACTCT) and box B (TGTCTCA), which mediate the up-regulation of promoter activity after [High glucose] HG stimulation."

Abscisic acid-responsive elements

Main article: Phosphate starvation-response transcription factor gene transcriptions

Abscisic acid-responsive elements (CACGTG).

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.

The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].

ACA boxes

Main article: H and ACA box gene transcriptions

The "3' end of mature hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."

ACGT-containing elements

Main article: ACGT-containing element gene transcriptions

The "binding affinities of both bZIP proteins were similar to CRE^A/T (ATGACGTCAT), a CRE sequence with flanking adenine and thymine (A/T) at positions -4 and +4. [The] bZIP domains of both STF1 and HY5 have similar binding properties for recognizing ACGT-containing elements (ACEs). [Although] the G-box is a known target site for the HY5 protein, the C-box sequences are the preferred binding sites for both STF1 and HY5."

Activating protein 2

Main article: Activating protein gene transcriptions

"AP-2 proteins can bind to G/C-rich elements, such as 5’-[G/C]CCN(3,4)GG[G/C]-3’ (41, 42)."

Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC.

Activating transcription factors

Main article: Activating transcription factor gene transcriptions

"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."

Adr1ps

Main article: Adr1p gene transcriptions

The upstream activating sequence (UAS) for Adr1p is 5'-TTGGGG-3' or 5'-TTGG(A/G)G-3'.

Aft1ps

Main article: Aft1p gene transcriptions

The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).

AGC boxes

Main article: AGC box gene transcriptions

"The GCC box, also referred to as the AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes whose expression is up-regulated following pathogen attack."

Androgen response elements

Main article: Androgen response element gene transcriptions

"The androgen response element sequence, 5'-GGTACACGGTGTTCT-3', was obtained from the National Center of Biotechnology Information (NCBI)."

5'-TGGAGAACAGCCTGTTCTCCA-3' or 5'-AGAACAGCCTGTTCT-3' "Using the identified AREs within our experiment a refined extended canonical ARE model is proposed and deposited in transcription factor databases [...]."

Angiotensinogen core promoter elements

Main article: Angiotensinogen core promoter element gene transcriptions

The consensus sequence is 5'-A/C-T-C/T-3'. The core nucleotides for AGCE1 include 5'-A/C-T-C/T-G-T-G-3', "located between the TATA box and transcription initiation site (positions −25 to −1) is an authentic regulator of human AG transcription."

Antioxidant-electrophile responsive elements

Main article: Antioxidant-electrophile responsive element gene transcriptions

5'-GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A-3' is the consensus sequence of a functional antioxidant response element at the HIF1A locus., an antioxidant response element (ARE).

ATA boxes

Main article: ATA box gene transcriptions

"The 3' flanking area contained the highly conserved hexanucleotide sequence A-A-T-A-A-A found in eukaryotic messages between the terminator codon and the polyadenylylation site (44)."

Auxin response factors

Main article: Auxin response factor gene transcriptions

The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)." "ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]. More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."

A more general consensus sequence may be 1(C/G/T)-2N-3(G/T)-4G-5(C/T)-6(C/T)-7N-8N-9N-10N, where ARF2[b] is 1(C/G/T)-2(A/C/T)-3(G/T)-4G-5(C/T)-6(C/T)-7(G/T)-8(C/G)-9(A/C/T)-10(A/G/T) and ARF5/MP[b] is 1(C/G/T)-2N-3(G/T)-4G-5T-6C-7(G/T)-8N-9-10N. ARF1[b] has 4G.

B boxes

Main article: B box gene transcriptions

While there appear to be at least two B boxes, TGGGCA is one B-box, where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the Dde I site at position -140 to the Dde I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."

The other is associated with the human transforming growth factor b1 binding sequences.

And, has the consensus sequence 5'-TGTCTCA-3'.

B recognition elements

Main article: Factor II B recognition element gene transcriptions

The factor II B recognition element is BRE^u.

"The transcription factor II B recognition elements BRE^u "CGACGCA" and BRE^d "ATGGTTG" were upstream (− 279 to − 273 of the transcript) and downstream (− 165 to − 159 of the transcript) of the TATA box, respectively."

The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.

The consensus sequence is 5’-G/C G/C G/A C G C C-3’.

CadC binding domains

Main article: CadC binding domain gene transcriptions

"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′." "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites." "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."

Calcineurin-responsive transcription factors

Main article: Calcineurin-responsive transcription factor gene transcriptions

The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p) is 5'-TG(A/C)GCCNC-3'.

Carbohydrate response elements

Main article: Carbohydrate response element gene transcriptions

"The putative ChREBP binding sites [are] ChoRE1 (CACGTGACCGGATCTTG, -324 to -308) and ChoRE2 (TCCGCCCCCATCACGTG, -298 to - 282) [...], where the 5-nt spacer [Carb and Carb1 is] between the two E-boxes in ChoRE motifs [CarbE1, CarbE2 and CarbE3]."

CAREs

Main article: CARE gene transcriptions

"GARE and a novel CARE (CAACTC regulatory elements) elements are present in the promoter of rice RAmy1A (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003)."

CArG boxes

Main article: CArG box gene transcriptions

"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of MADS box proteins (Ito et al., 2008)."

"MADS-box proteins bind to a consensus sequence, the CArG box, that has the core motif CC(A/T)₆GG (15)."

"Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [...]."

Three "other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins." These together with the core motif CC(A/T)₆GG (15) suggest a more general CArG-box motif of (C(C/A/T)(A/T)₆(A/G)G).

Cat8p gene transcriptions

Main article: Cat8p gene transcriptions

The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T, B = C, G, T, V = A, C, G, M = A, C, and H = A, C, T; i.e. 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'.

CAT boxes

Main article: CAT box gene transcriptions

"The M-CAT consensus sequence [is] CATTCCT".

"A [chloramphenicol acetyltransferase] CAT-box-like element, GCCATT [34], adjacent to the GC-box, is conserved in the three promoters."

C boxes

Main article: C box gene transcriptions

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C-box) [...]."

Analysis "of the recombinant (soybean [Glycine max] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."

The human ribosomal protein L11 gene (HRPL11) has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].

"Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA)."

Substituting T for U yields C box = 5'-AGTAGT-3' in the translation direction on the template strand.

CCAAT-box-binding transcription factors

Main article: Nuclear factor gene transcriptions

The upstream activating sequence (UAS) for the Hap4p is 5'-CCAAT-3'.

CGCG boxes

Main article: CGCG box gene transcriptions

"The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T)."

Circadian control elements

Main article: Circadian control element gene transcriptions

"The circadian control element (circadian; Anderson et al., 1994) was found in 10 FvTCP genes."

Circadian control elements (CAANNNNATC).

Cold-responsive elements

Main article: Cold-responsive element gene transcriptions

A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."

Coupling elements

Main article: Coupling element gene transcriptions

"In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996)."

"In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."

"To identify potential cis-regulatory elements in the promoter sequences of ZmGRXCC genes, the 1500 bp sequences of each [maize CC-type glutaredoxin (GRX)] ZmGRXCC gene upstream of the ATG start codon were selected from the maize genome as the promoter, and the promoter sequence was screened using PlantCARE [32]. The elements searched included [...] CE3 (coupling element 3, -CACGCG-) for ABA responsiveness [...]."

CRE boxes

Main article: CRE box gene transcriptions

"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."

The upstream activating sequence (UAS) for the Aca1p, the basic "leucine zipper (bZIP) transcription factor [55] involved in carbon source utilization" is 5'-TGACGTCA-3' the same as a CRE.

The upstream activating sequence (UAS) for the Sko1p, involved "in osmotic and oxidative stress responses" is 5'-TGACGTCA-3' the same as a CRE.

DAF-16 binding elements

Main article: DAF-16 binding element gene transcriptions

"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)^11–13."

D boxes

Main article: C and D box gene transcriptions

Main article: D box gene transcriptions

There is one D box 5'-AGTCTG-3'.

The human ribosomal protein L11 gene (HRPL11) has two potential snRNA-coding sequences in intron 4: a D box beginning at +4237 (TCCTG).

A D-box is (TGAGTGG).

Downstream B recognition elements

Main article: Downstream TFIIB recognition element gene transcriptions

The downstream B recognition element [(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)] designated as the BRE^d, or dBRE, is an additional core promoter element that occurs downstream of the TATA box and is recognized by general transcription factor II B.

Downstream core elements

Main article: Downstream core element gene transcriptions

A core promoter that contains all three subelements of the downstream core element [DCE] may be much less common than one containing only one or two. "S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34."

The consensus sequence for the DCE is CTTC...CTGT...AGC. These three consensus elements are referred to as subelements: "S_I is CTTC, S_II is CTGT, and S_III is AGC."

Downstream promoter elements

Main article: Downstream promoter element gene transcriptions

The DPE consensus sequence is the more general sequence RGWYVT, or (A/G)G(A/T)(C/T)(A/C/G)T.

The DPE in "the ATP‐binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" is 5'-AGTCTC-3'.

E2 boxes

Main article: E2 box gene transcriptions

"The most dramatic impact on immunoglobulin gene enhancer activity was observed upon mutation of sites that contain an E2-box motif (G/ACAGNTGN)."

EIN3 binding sites

Main article: EIN3 binding site gene transcriptions

"We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gene [...]."

"EIN3/EIL1 transcription factors were reported to bind to a consensus DNA sequence of A[CT]G[AT]A[CT]CT [34,35]."

Endoplasmic reticulum stress response elements

Main article: Endoplasmic reticulum stress response element gene transcriptions

"The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response element (ERSE) containing the consensus sequence CCAAT-N9-CCACG to activate genes encoding ER chaperones, ERAD components, and XBP1 (Chen et al., 2010; Yamamoto et al., 2004; Yoshida et al., 2001)."

Endosperm expression

Main article: Endosperm expression gene transcriptions

Endosperm expression (TGTGTCA).

Enhancer boxes

Main article: Enhancer box gene transcriptions

The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence of CACGTG.

Ethylene responsive elements

Main article: Ethylene responsive element gene transcriptions

Ethylene responsive elements (ATTTCAAA).

Forkhead boxes

Main article: Forkhead box gene transcriptions

"Most paralogous FOX proteins bind to the canonical DNA response element 5′-RYAAAYA-3′ (R = A or G, Y = C or T)^11–13."

GAAC elements

Main article: GAAC element gene transcriptions

"[A] short sequence [in TSE1 contains] a GAACT motif that [binds] a tendon-specific nuclear protein."

GA responsive elements

Main article: GARE gene transcriptions

"Although this GARC [GA responsive complex] may not always be tripartite, most often it includes three sequence motifs, the TAACAAA box or GA responsive element (GARE), the pyrimidine box CCTTTT, and the TATCCAC box (Skriver et al., 1991;Gubler and Jacobsen, 1992; Rogers et al., 1994)."

Several GA-responsive cis-acting elements (GARE) and GARE-like elements (TAACAA/GA, or TAACGTA) have been identified in the promoters of hydrolase genes expressed in the aleurone (Ueguchi-Tanaka et al. 2000; Sutoh and Yamauchi 2003; Washio 2003), expansin genes expressed in internodes (Lee et al. 2001), and many GAMYB-regulated genes expressed in anthers (Tsuji et al. 2006)."

GATA boxes

Main article: GATA gene transcriptions

GTGA-box has the consensus sequence GATA.

GC boxes

Main article: GC box gene transcriptions

"A GC box sequence, one of the most common regulatory DNA elements of eukaryotic genes, is recognized by the Spl transcription factor; its consensus sequence is represented as 5'-G/T G/A GGCG G/T G/A G/A C/T-3' [or 5′-KRGGCGKRRY-3′] (Briggs et al., 1986)."

Gcn4ps

Main article: Gcn4p gene transcriptions

"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."

"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -􏰉206 and -􏰉112, respectively, [...]."

Gibberellin responsive elements

Main article: Gibberellin responsive element gene transcriptions

Gibberellin responsive elements (CCTTTTG, AAACAGA).

Γ-interferon activated sequences

Main article: Γ-interferon activated sequence gene transcriptions

"Computer analysis of the nt −653 to nt −483 region identified two sites that resemble the [γ-interferon activated sequence] GAS consensus sequence, TTNCNNNAA (19). Similar GAS-like sites have been shown to mediate the effects of various cytokines, including [growth hormone] GH, on the transcription of other genes (19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt −633 and nt −625; the second site, TTAGACAAA (ALS-GAS2), is located between nt −553 and nt −545."

Glucocorticoid response elements

Main article: Glucocorticoid response element gene transcriptions

"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."

Gcr1ps

Main article: Gcr1p gene transcriptions

The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in the regulation of glycolysis [77].

GT boxes

Main article: TC element gene transcriptions

"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."

Hac1s

Main article: Hac1p gene transcriptions

"The similar UPRE-1 is also found in the promoter region of the P. pastoris KAR2 (CAGCGTG), INO1 (CAACTTG) and HAC1 (CAACTTG) genes [15]. The presence of an HAC1 UPRE implies that Hac1p can up-regulate its own transcription. Unconventional splicing of HAC1 mRNA after ER stress signaling generates the active form of basic leucine zipper (bZIP) transcription factor Hac1p, which binds to the UPRE [16]."

H boxes

Main article: H box gene transcriptions

"The box H/ACA snoRNAs [...] have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity."

The "3' end of mature [human telomerase] hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."

"Comparison with the murine telomerase RNA (mTR) (7) suggests that the snoRNA-like features of hTR are evolutionarily conserved. The mTR 3' end [...] includes consensus H (5'-ACAGGA-3') and ACA box sequences."

An H box has a consensus sequence of 3'-ACACCA-5'.

"The KAP-2 protein [...] binds to the H-box (CCTACC) element in the bean CHS15 chalcone synthase promoter".

"In humans, telomerase is composed of a reverse transcriptase (hTERT), which uses the RNA component (hTERC) to dock onto the 3′ single-stranded telomere end. hTERT may then processively synthesise telomeric repeats from the template provided by hTERC, before dissociating^7–9. All telomerase RNAs possess a 3′ end element necessary for its stability¹⁰. In hTERC, this is two stem-loop structures separated by an H-box (ANANNA) and ACA motif (H/ACA). The binding of telomerase factors dyskerin, NOP10, and NHP2 at the H/ACA motif form the so-called ‘pre-ribonucleoprotein complex’, before GAR1 binds in transition to the mature RNP^11,12. hTERC then binds to chaperone TCAB1, which assists its trafficking to the Cajal bodies where the functional telomerase complex localises¹³. Recruitment to the telomeres in S-phase is mediated by the protective complex shelterin^14,15. Correct assembly of the telomerase complex, with appropriate co-factors for maturation, stability, and subcellular localisation, is necessary for its function and thus telomere maintenance."

Heat shock elements

Main article: Hsf1p gene transcriptions

"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In Saccharomyces cerevisiae, this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."

"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."

Hex sequences

Main article: Hex sequence gene transcriptions

The Hex sequence has the consensus (TGACGTGGC).

HMG boxes

Main article: HMG box gene transcriptions

"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."

HNFs

Main article: HNF gene transcriptions

Gene ID: 6927 is HNF1A HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."

"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1." TCF-1 binding site is CCTTTGA.

"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."

Homeoboxes

Main article: Homeobox gene transcriptions

"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."

The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln₅₀ in TTF-1 HD is utilized for DNA recognition."

Hsf1ps

Main article: Hsf1p gene transcriptions

The upstream activating sequence (UAS) for the Hsf1p is 5'-NGAAN-3' or 5'-(A/C/G/T)GAA(A/C/G/T)-3'.

Hypoxia response elements

Main article: ABA-response element gene transcriptions

"The hypoxia response element (HRE) and estrogen response element (ERE) were located on −154 to −150 "ACGTG", and −94 to −80 "AGGTTATTGCCTCCT" on the transcript, respectively."

HY boxes

Main article: HY box gene transcriptions

"Deletion analysis by a series of 5′-deletion constructs identified the responsive region to RUNX-2 as being between −81 bp and −76 bp, containing a putative RUNX-2 binding sequence (TGAGGG), which is similar to that identified in the promoter region of human interleukin-3 (TGTGGG) (33)."

Initiator elements (YYANWYY)

Main article: Initiator element gene transcriptions

The Inr has the consensus sequence YYANWYY.

Initiator elements (BBCABW)

Main article: Initiator element gene transcriptions

"Kadonaga and colleagues (Vo ngoc et al. 2017) devised and implemented a novel multistep approach that combines experimental and computational methods to reinvestigate the human Inr consensus sequence. First, they generated two 5′-GRO-seq (5′ end-selected global run-on followed by sequencing) libraries with human MCF-7 cells to identify the 5′ ends of nascent capped transcripts. Second, they developed a peak-calling algorithm named FocusTSS to find transcripts in the 5′-GRO-seq data sets that were initiated at a focused position on the genome, hence identifying clear TSSs to enable analysis of Inr sequences. FocusTSS identified 7678 TSSs that were in both data sets. Third, to identify sequence motifs enriched among the focused TSSs, they used the HOMER motif discovery tool (Heinz et al. 2010), which yielded an Inr-like consensus sequence of BBCABW from −3 to +3 (where, B = C/G/T, W = A/T, and +1 is [A]). Forty percent of the focused TSSs contained a perfect match to the BBCABW consensus Inr."

Initiator-like element, TCT

Main article: Initiator element gene transcriptions

Consensus sequence for an Inr-like/TCT is TTCTCT.

Interferon regulatory factors

Main article: Interferon regulatory factor gene transcriptions

Consensus sequence for IRF-3 is 5'-GCTTTCC-3'.

Jasmonic acid-responsive elements

Main article: Jasmonic acid-responsive element gene transcriptions

Jasmonic acid-responsive elements (TGACG, CGTCA).

Krüppel-like factors

Main article: Krüppel-like factor gene transcriptions

"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."

"Using the in vitro CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."

M35 boxes

Main article: M35 box gene transcriptions

The trp promoter has a consensus -35 sequence (TTGACA).

Met31ps

Main article: Met31p box gene transcriptions

Consensus sequence for Met31 binding motif is AAACTGTGG in sulfur amino acid metabolism.

"Both Met31p and Met32p bind to the 5′‐AAACTGTG‐3′ core sequence which is, besides the 5′‐TCACGTG‐3′ element, the second regulatory element known to be involved in the regulation of several MET genes (Thomas et al., 1989)."

Metal responsive elements

Main article: Metal responsive element gene transcriptions

"To execute the transcriptional regulation, [Metal-responsive transcription factor-1] MTF-1 binds to the specific site, called [metal responsive element] MRE (core sequence = TGCRCNC), in the promoter region of target gene (Günther et al. 2012a)."

Middle sporulation elements

Main article: Middle sporulation element gene transcriptions

"These genomic sequences were analysed for the presence of [...] middle sporulation elements (MSE) motif (5'-ACACAAA-3') using the NCBI BLAST tool."

Of the midsporulation element (MSE), "a minimal element, CRCAAA(A/T), is sufficient for sporulation specificity."

Mig1ps

Main article: Mig1p gene transcriptions

The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or 5'-(C/G)(C/T)GGGG-3'.

Msn2,4p

Main article: Msn2,4p gene transcriptions

The upstream activating sequence (UAS) for the Msn2,4p transcription factor is 5'-CCCCT-3'.

"[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core pentameric cis-acting sequence CCCCT and is located in promoter regions of the induced genes."

MYB recognition elements

Main article: MYB recognition element gene transcriptions

"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."

MYB binding site involved in drought induction (TAACTG).

Myocyte enhancer factor 2 (MEF2)

Main article: Myocyte enhancer factor gene transcriptions

Myocyte enhancer factor-2 (MEF2) proteins are a family of transcription factors which through control of gene expression are important regulators of cellular differentiation and consequently play a critical role in embryonic development. In adult organisms, Mef2 proteins mediate the stress response in some tissues.

"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif." Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).

Nuclear factor kappa-light-chain-enhancer of activated B cells

Main article: Nuclear factor gene transcriptions

The "natural 11 bp 𝜿B binding site MHC H-2 [is 5'-CCCCTAAGGGG-3'] which is well ordered in our structure."

Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC).

Nuclear factor of activated T cell transcriptions

Main article: Nuclear factor of activated T cell gene transcriptions (NFAT)

Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).³"

Nuclear factor 1

Main article: Nuclear factor gene transcriptions

Nuclear factor 1 (NF-1) is a family of closely related transcription factors that constitutively bind as dimers to specific sequences of DNA with high affinity. Family members contain an unusual DNA binding domain that binds to the recognition sequence 5'-TTGGCXXXXXGCCAA-3'.

Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.

An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).

Nutrient-sensing response element 1

There is only one nucleotide difference between the SESN2 CARE and the ATF4-inducible asparagine synthase gene ASNS consensus sequence (GTTTCATCA).

Oaf1 transcription factors

Main article: Oaf1p gene transcriptions

The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN₃TNAN_9-12CCG-3'.

ORE1 binding sites

Main article: ORE1 binding site gene transcriptions

"As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [37]."

Consensus sequences are 5'-(A/C/G)(A/C)GT(A/G)N_5,6(C/T)AC(A/G)-3' or 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.

p53 response elements

Main article: P53 response element gene transcriptions

"A p53 consensus DNA RE is composed of a tandem of two decameric palindromic sequences (half-sites) 5′-RRRCWWGYYY-3′, where R = purine, Y = pyrimidine and W is either A or T. There is a variability in composition of p53 REs, thus two half-sites can be separated by a spacer DNA, typically 0–13 bp in length and many p53 DNA REs have varying numbers of half-sites (19,20,22,33–37)."

p63 DNA-binding sites

Main article: P63 DNA-binding site gene transcriptions

"p63 bound preferentially to DNA fragments conforming to the 20 bp sequence 5'-RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY-3'."

P boxes

Main article: P box gene transcriptions

"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."

Peroxisome proliferator-activated receptor alpha

Main article: Peroxisome proliferator-activated receptor alpha

Consensus sequence is 5'-CGACCCC-3'.

Peroxisome proliferator hormone response elements

Main article: Peroxisome proliferator hormone response element gene transcriptions

"After activation by ligands, PPARs/RXRs heterodimers bind to PPRE consensus sequence (AGGTCANAGGTCA) in the promoter of their target genes."

Phosphate starvation-response transcription factors

Main article: Phosphate starvation-response transcription factor gene transcriptions

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.

The upstream activating sequence (UAS) for Pho4p is 5'-CAC(A/G)T(T/G)-3' in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].

Pollen1 elements

Main article: Pollen1 element gene transcriptions

"Electrophoretic mobility shift assays identified a pollen-specific cis-acting element POLLEN1 (AGAAA) mapped at AtACBP4 (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."

"Given that AtACBP4pro::GUS (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 cis-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."

"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato LAT52 (Bate and Twell 1998)."

Pribnow boxes

Main article: Pribnow box gene transcriptions

"Two domains upstream of the start site of transcription have been identified for which a consensus sequence has been formulated(1-5). These domains are the -35 sequence (5'-T-T-G-A-C-A) and the Pribnow box (5'-T-A-T-A-A-T) in the -10 region. Both domains are in close contact with the RNA polymerase during initiation of RNAsynthesis (2,6)."

Prolamin boxes

Main article: Prolamin box gene transcriptions

"The main cis-element present in their promoters is an endosperm-specific box [19,20], which consists of two motifs: a GLM (GCN4-like motif) (5′ G(A)TGA(G) GTCAT 3′) that shares homology with yeast GCN4 [21], and a 7 bp P-box (Prolamin box) (5′TGTAAAG3′) [22–24]."

Pyrimidine boxes

Main article: Pyrimidine box gene transcriptions

"Prediction of cis-regulatory elements using bioinformatics tools: Upstream 1500bp sequence of transcriptional start site of each gene were searched using PLANTCARE database to identify the cis-regulatory elements of NtSUT1-5 genes. Moreover, manual scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."

"Promoter analysis of five SUTs revealed the presence of sugar responsive element, A-box (TACGTA), which is involved in regulation of sucrose transporters upon addition of sucrose (Kühn, 2011; Osuna et al., 2007). Sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) important for sugar responsive gene expression, pyrimidine box (CCTTTT) (Washio, 2003) partially involved in sugar repression were also observed."

Q elements

Main article: Q element gene transcriptions

"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."

The consensus sequence for a Q element is 5'-AGGTCA-3'.

Copying the apparent consensus sequence for the QE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 or three between ZNF497 and A1BG as can be found by the computer programs.

Rap1 regulatory factors

Main article: Rap1 regulatory factor gene transcriptions

Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).

"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."

Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.

Reb1 general regulatory factors

Main article: Reb1 general regulatory factor gene transcriptions

Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."

Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.

Retinoblastoma control elements

Main article: TC element gene transcriptions

"Robbins et al. (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-fos and have identified an element, termed the retinoblastoma control element (RCE), in the c-fos promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-β1, -β2, and -β3 promoters by Kim et al. (19)."

"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."

"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-O-tetradecanoylphorbol-13-acetate (TPA) (15-20)."

Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."

Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-O-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).

"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human PAI-1 gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."

"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."

D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).

Retinoic acid response elements

Main article: Retinoic acid response element gene transcriptions

Retinoic acid response elements (RAREs).

"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."

"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."

"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, vitamin D receptors (VDR) and peroxisome proliferator-activated receptors (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."

Additional response elements that include the 5'-AGGTCA-3' are Q elements, ROR-response elements and Thyroid hormone response elements.

A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.

Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.

Root specific elements

Main article: Root specific element gene transcriptions

Root specific elements (TGACGTCA).

ROR-response elements

Main article: ROR-response element gene transcriptions

RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)^{13, 31}."

Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

R response elements

Main article: MYB recognition element gene transcriptions

The consensus sequence for the RRE is 5'-CATCTG-3'.

Serum response elements

Main article: CArG box gene transcriptions

Main article: Enhancer box gene transcriptions

Main article: Serum response element gene transcriptions

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.

5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.

5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.

5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".

5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.

Servenius sequences

Main article: Servenius sequence gene transcriptions

The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."

Specificity proteins

Main article: Specificity protein gene transcriptions

Main article: Sp1 gene transcriptions

Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).

"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."

Sp-1 (CCGCCCC).

Sp1 (GCGGC).

SP1 (GGGGCGGGCC).

An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 5'-(C/G)(C/G/T)G(C/G)C(C/T)-3'. Or, each must be considered separately.

Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.

STATs

Main article: STAT gene transcriptions

A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.^(37–40)" Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.

"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."

Ste12p

Main article: Ste12p gene transcriptions

The upstream activating sequence (UAS) for [Sterile 12 protein] Ste12p is 5'-TGAAAC-3'.

Sucrose boxes

Main article: Sucrose box gene transcriptions

Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 1999) and pyrimidine box (CCTTTT, TTTTTTCC) (Washio, 2003)."

Synaptic Activity-Responsive Elements

Main article: Synaptic Activity-Responsive Elements

"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."

"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."

The consensus sequence for the myocyte enhancer factor 2 (MEF2) is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.

TACTAAC boxes

Main article: TACTAAC box gene transcriptions

"A consensus sequence TACTAA(C/T) was derived for the branch site of Dictyostelium introns."

TAGteams

Main article: TAGteam gene transcriptions

The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."

Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.

Tapetum boxes

Main article: Tapetum box gene transcriptions

The consensus sequence for the TAPETUM box is TCGTGT.

TATA boxes

Main article: TATA box gene transcriptions

"About 24% of human genes have a TATA-like element and their promoters are generally AT-rich; however, only ~10% of these TATA-containing promoters have the canonical TATA box (TATAWAWR)."

TAT boxes

Main article: TAT box gene transcriptions

Only an inverse and its complement occurs between ZSCAN22 and A1BG: 5'-TACCTAT-3' at 2996 nts from ZSCAN22.

T boxes

Main article: T box gene transcriptions

"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."

"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."

Copying the consensus T boxes: 5'-TCACACCT-3' or 5'-AACGTT-3' and putting the sequence in "⌘F" finds two locations or zero for these sequences respectively between ZSCAN22 or ZNF497 and A1BG as can be found by the computer programs.

Telomeric repeat DNA-binding factors

Main article: Telomeric repeat DNA-binding factor gene transcriptions

Copying the consensus telomeric repeat DNA-binding factor (TRF): 5'-TTAGGG-3' and putting the sequence in "⌘F" locates ten of this sequence between ZSCAN22 and A1BG in the negative direction and two nucleotides between ZNF497 and A1BG as can be found by the computer programs.

In the nucleotides between ZSCAN22 and A1BG there is are ten 5'-TTAGGG-3' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.

Homo sapiens genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".

Thyroid hormone response elements

Main article: Thyroid hormone response element gene transcriptions

"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."

Copying the consensus sequence for the TRE: 5'-AGGTCA-3' and putting the sequence in "⌘F" finds no locations between ZNF497 and A1BG or two locations between ZSCAN22 and A1BG as can be found by the computer programs.

Transcription factor 3

Main article: Transcription factor 3 gene transcriptions

Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a protein that in humans is encoded by the TCF3 gene. TCF3 has been shown to directly enhance Hes1 (a well-known target of Notch signaling) expression.

This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. The 9aaTAD transactivation domains of E proteins and MLL are very similar and both bind to the KIX domain of general transcriptional mediator CBP. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development.

Consensus sequence found in the promoter of TUG1 is 5'-GTCTGGT-3'.

Upstream stimulating factors

Main article: Upstream stimulatory factor gene transcriptions

"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."

"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important cis-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson et al., 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre et al., 1989)."

"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam et al., 1990a), is GCCACCGG."

"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."

A likely general USF box consensus sequence may be 5'-GCC(A/T)NN(C/G/T)(A/G)-3'.

V boxes

Main article: V box gene transcriptions

"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."

In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.

In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.

W boxes

Main article: W box gene transcriptions

The "presence of WRKY TF binding sites (C/TTGACC/T, W boxes) in numerous co-regulated Arabidopsis defense gene promoters provided circumstantial evidence that zinc-finger-type WRKY factors play a broad and pivotal role in regulating defenses [10]."

The W box is a DNA cis-regulatory element sequence, (T)TGAC(C/T), which is recognized by the family of WRKY transcription factors.

X core promoter elements

Main article: X core promoter element gene transcriptions

"[T]he X gene core promoter element 1 ... is located between nucleotides -8 and +2 relative to the transcriptional start site (+1) and has a consensus sequence of G/A/T-G/C-G-T/C-G-G-G/A-A-G/C₊₁-A/C."

Xenobiotic responsive elements

Main article: Xenobiotic responsive element gene transcriptions

The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), contains the core sequence 5'-GCGTG-3' within the consensus sequence 5'-T/GNGCGTGA/CG/CA-3' in the promoter region of AhR responsive genes. The AhR/ARNT heterodimer directly binds the AHRE/DRE/XRE core sequence in an asymmetric manner such that ARNT binds to 5'-GTG-3' and AhR binding 5'-TC/TGC-3'. Recent research suggests that a second type of element termed AHRE-II, 5'-CATG(N6)C[T/A]TG-3', is capable of indirectly acting with the AhR/ARNT complex.

YY1

Main article: YY1 gene transcriptions

YY1 consensus sequence is 5'-CCATTTA-3' and 5'-CCATCTT-3'.

Z boxes

Main article: Z box gene transcriptions

"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of RbcS1A (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."

Z-boxes 1-3 contain 5'-AGGTG-3'.

Response element positive results

Main article: A1BG response element positive results

Response element negative results

Main article: A1BG response element negative results

Hypotheses

1. Downstream core promoters may work as transcription factors even as their complements or inverses.
2. In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
3. Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
4. The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.

See also

• A1BG gene transcription core promoters
• A1BG gene transcriptions
• A1BG regulatory elements and regions
• A1BG response element negative results
• A1BG response element positive results
• Alpha-1-B glycoprotein
• Complex locus A1BG and ZNF497
• Immunoglobulin domain cl11960
• Immunoglobulin like domain cd05751
• Immunoglobulin like domain pfam13895
• Immunoglobulin like domain smart00410
• Immunoglobulin supergene family
• Nuclear factor gene transcriptions
• SCAN domain

External links

• GenomeNet KEGG database
• Home - Gene - NCBI
• NCBI All Databases Search
• NCBI Site Search

{{Phosphate biochemistry}}